Add nf-core module and subworkflow mirdeep2

modules/nf-core/mirdeep2/mapper/environment.yml

@@ -0,0 +1,7 @@
+---
+# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json
+channels:
+  - conda-forge
+  - bioconda
+dependencies:
+  - "bioconda::mirdeep2=2.0.1.2"

modules/nf-core/mirdeep2/mapper/main.nf

@@ -0,0 +1,53 @@
+process MIRDEEP2_MAPPER {
+    tag "$meta.id"
+    label 'process_medium'
+
+    conda "${moduleDir}/environment.yml"
+    container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
+        'https://depot.galaxyproject.org/singularity/mirdeep2:2.0.1.2--0':
+        'biocontainers/mirdeep2:2.0.1.2--0' }"
+
+    input:
+    tuple val(meta), path(reads)
+    tuple val(meta2), path(index, stageAs: '*')
+
+    output:
+    tuple val(meta), path('*.fa'), path('*.arf'), emit: outputs
+    path "versions.yml"                         , emit: versions
+
+    when:
+    task.ext.when == null || task.ext.when
+
+    script:
+    def args = task.ext.args ?: ''
+    def prefix = task.ext.prefix ?: "${meta.id}"
+    def VERSION = '2.0.1'
+
+    """
+    mapper.pl \\
+    ${reads} \\
+    $args \\
+    -p ${index}/${meta2.id}  \\
+    -s ${prefix}_collapsed.fa \\
+    -t ${prefix}_reads_collapsed_vs_${meta2.id}_genome.arf
+
+    cat <<-END_VERSIONS > versions.yml
+    "${task.process}":
+        mirdeep2: \$(echo "$VERSION")
+    END_VERSIONS
+    """
+
+    stub:
+    def args = task.ext.args ?: ''
+    def prefix = task.ext.prefix ?: "${meta.id}"
+    def VERSION = '2.0.1'
+    """
+    touch ${prefix}.fa
+    touch ${prefix}reads_vs_refdb.arf
+
+    cat <<-END_VERSIONS > versions.yml
+    "${task.process}":
+        mirdeep2: \$(echo "$VERSION")
+    END_VERSIONS
+    """
+}

modules/nf-core/mirdeep2/mapper/meta.yml

@@ -0,0 +1,50 @@
+name: "mirdeep2_mapper"
+description: |
+  miRDeep2 Mapper is a tool that prepares deep sequencing reads for downstream miRNA detection by collapsing reads, mapping them to a genome, and outputting the required files for miRNA discovery.
+keywords:
+  - mirdeep2
+  - mapper
+  - RNA sequencing
+tools:
+  - "mirdeep2":
+      description: |
+        miRDeep2 Mapper (`mapper.pl`) is part of the miRDeep2 suite. It collapses identical reads, maps them to a reference genome, and outputs both collapsed FASTA and ARF files for downstream miRNA detection and analysis.
+      homepage: "https://www.mdc-berlin.de/content/mirdeep2-documentation"
+      documentation: "https://www.mdc-berlin.de/content/mirdeep2-documentation"
+      tool_dev_url: "https://github.com/rajewsky-lab/mirdeep2"
+      doi: "10.1093/nar/gkn491"
+      licence: ["GPL V3"]
+      identifier: biotools:mirdeep2
+
+input:
+  - - meta:
+        type: map
+        description: Groovy Map containing sample information, e.g. `[ id:'sample1',
+          single_end:false ]`
+    - reads:
+        type: file
+        description: File containing the raw sequencing reads that need to be collapsed
+          and mapped to a reference genome.
+        pattern: "*.fa"
+  - - meta2:
+        type: map
+        description: Groovy Map containing information about the genome index.
+    - index:
+        type: file
+        description: Path to the genome index file used for mapping the reads to the
+          genome.
+        pattern: "*"
+output:
+  - outputs:
+      - meta: {}
+      - "*.fa": {}
+      - "*.arf": {}
+  - versions:
+      - versions.yml:
+          type: file
+          description: File containing software versions for tracking.
+          pattern: "versions.yml"
+authors:
+  - "@atrigila"
+maintainers:
+  - "@atrigila"

modules/nf-core/mirdeep2/mapper/tests/main.nf.test

@@ -0,0 +1,141 @@
+
+nextflow_process {
+
+    name "Test Process MIRDEEP2_MAPPER"
+    script "../main.nf"
+    process "MIRDEEP2_MAPPER"
+
+    tag "modules"
+    tag "modules_nfcore"
+    tag "mirdeep2"
+    tag "bowtie/build"
+    tag "mirdeep2/mapper"
+    tag "seqkit/fq2fa"
+    tag "seqkit/replace"
+
+
+    setup {
+        run("BOWTIE_BUILD") {
+            script "../../../bowtie/build/main.nf"
+            process {
+            """
+            input[0] = [
+                        [ id:'genome_cel_cluster' ], // meta map
+                    file('https://github.com/rajewsky-lab/mirdeep2/raw/master/tutorial_dir/cel_cluster.fa', checkIfExists: true)
+            ]
+            """
+            }
+        }
+
+        run("SEQKIT_FQ2FA") {
+            script "../../../seqkit/fq2fa/main.nf"
+            process {
+            """
+            input[0] = [
+                        [ id:'small_Clone1_N1' ], // meta map
+                    file('https://github.com/nf-core/test-datasets/raw/smrnaseq/testdata/trimmed/small_Clone1_N1.fastp.fastq.gz', checkIfExists: true)
+            ]
+            """
+            }
+        }
+
+        run("SEQKIT_REPLACE") {
+            script "../../../seqkit/replace/main.nf"
+            config "./nextflow.config"
+            process {
+            """
+            input[0] = SEQKIT_FQ2FA.out.fasta
+            """
+            }
+        }
+
+    }
+
+    test("mirdeep2 - mapper - fasta celegans") {
+        config "./nextflow.config"
+
+        when {
+            process {
+                """
+            input[0] = [
+                        [ id:'test_reads', single_end:false ], // meta map
+                    file('https://github.com/rajewsky-lab/mirdeep2/raw/master/tutorial_dir/reads.fa', checkIfExists: true)
+            ]
+            input[1] = BOWTIE_BUILD.out.index
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert snapshot(process.out.versions).match() },
+
+                // md5sum not stable - IDs change while sequences are the same
+
+                // Assert TCACCGGGGGTACATCAGCTAA occurs once
+                { assert file(process.out.outputs[0][1]).readLines().findAll { it.contains("TCACCGGGGGTACATCAGCTAA") }.size() == 1 },
+
+                // Assert seq_347479_x287 occurs once
+                { assert file(process.out.outputs[0][1]).readLines().findAll { it.contains("seq_347479_x287") }.size() == 1 },
+
+                // Assert that specific content occurs 4 times
+                { assert file(process.out.outputs[0][2]).readLines().findAll { it.contains("21\t1\t21\ttcaccgggtgtaaatcagctt\tchrII:11534525-11540624\t21\t3535\t3555\ttcaccgggtgtaaatcagctt\t+\t0\tmmmmmmmmmmmmmmmmmmmmm") }.size() == 4 }
+            )
+        }
+
+    }
+
+    test("mirdeep2 - mapper - fasta smrnaseq") {
+        config "./nextflow.config"
+
+        when {
+            process {
+                """
+            input[0] = SEQKIT_REPLACE.out.fastx
+            input[1] = BOWTIE_BUILD.out.index
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+
+                // Assert reads occurs once
+                { assert file(process.out.outputs[0][1]).readLines().findAll { it.contains("TACCTGAGGTAGCAGGTTGTATAGTTGGGG") }.size() == 1 },
+
+                // Assert ID occurs once
+                { assert file(process.out.outputs[0][1]).readLines().findAll { it.contains("seq_996152_x1") }.size() == 1 }
+
+                )
+        }
+
+    }
+
+    test("mirdeep2 - fasta - stub") {
+
+        options "-stub"
+
+        when {
+            process {
+                """
+            input[0] = [
+                        [ id:'test_reads', single_end:false ], // meta map
+                    file('https://github.com/rajewsky-lab/mirdeep2/raw/master/tutorial_dir/reads.fa', checkIfExists: true)
+            ]
+            input[1] = BOWTIE_BUILD.out.index
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert snapshot(process.out).match() }
+            )
+        }
+
+    }
+
+}

modules/nf-core/mirdeep2/mapper/tests/main.nf.test.snap

@@ -0,0 +1,51 @@
+{
+    "mirdeep2 - fasta - stub": {
+        "content": [
+            {
+                "0": [
+                    [
+                        {
+                            "id": "test_reads",
+                            "single_end": false
+                        },
+                        "test_reads.fa:md5,d41d8cd98f00b204e9800998ecf8427e",
+                        "test_readsreads_vs_refdb.arf:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "1": [
+                    "versions.yml:md5,33c794292d6772d67fa8001439394614"
+                ],
+                "outputs": [
+                    [
+                        {
+                            "id": "test_reads",
+                            "single_end": false
+                        },
+                        "test_reads.fa:md5,d41d8cd98f00b204e9800998ecf8427e",
+                        "test_readsreads_vs_refdb.arf:md5,d41d8cd98f00b204e9800998ecf8427e"
+                    ]
+                ],
+                "versions": [
+                    "versions.yml:md5,33c794292d6772d67fa8001439394614"
+                ]
+            }
+        ],
+        "meta": {
+            "nf-test": "0.9.0",
+            "nextflow": "24.04.4"
+        },
+        "timestamp": "2024-09-20T20:58:19.544297445"
+    },
+    "mirdeep2 - mapper - fasta celegans": {
+        "content": [
+            [
+                "versions.yml:md5,33c794292d6772d67fa8001439394614"
+            ]
+        ],
+        "meta": {
+            "nf-test": "0.9.0",
+            "nextflow": "24.04.4"
+        },
+        "timestamp": "2024-09-17T17:41:05.101661825"
+    }
+}

modules/nf-core/mirdeep2/mapper/tests/nextflow.config

@@ -0,0 +1,11 @@
+process {
+    withName: 'MIRDEEP2_MAPPER' {
+        ext.args = "-c -j -k TCGTATGCCGTCTTCTGCTTGT  -l 18 -m -v"
+    }
+
+    withName: 'SEQKIT_REPLACE' {
+        ext.args          = "-p '\s.+'"
+        ext.suffix        = "fasta"
+    }
+
+}

modules/nf-core/mirdeep2/mirdeep2/environment.yml

@@ -0,0 +1,7 @@
+---
+# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json
+channels:
+  - conda-forge
+  - bioconda
+dependencies:
+  - "bioconda::mirdeep2=2.0.1.2"

modules/nf-core/mirdeep2/mirdeep2/main.nf

@@ -0,0 +1,64 @@
+process MIRDEEP2_MIRDEEP2 {
+    tag "$meta.id"
+    label 'process_medium'
+
+    conda "${moduleDir}/environment.yml"
+    container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
+        'https://depot.galaxyproject.org/singularity/mirdeep2:2.0.1.2--0':
+        'biocontainers/mirdeep2:2.0.1.2--0' }"
+
+    input:
+    tuple val(meta), path(processed_reads), path(genome_mappings)
+    tuple val(meta2), path(fasta)
+    tuple val(meta3), path(mature), path(hairpin), path(mature_other_species)
+
+    output:
+    tuple val(meta), path("result*.{bed,csv,html}")    , emit: outputs
+    path "versions.yml"                                , emit: versions
+
+    when:
+    task.ext.when == null || task.ext.when
+
+    script:
+    def args = task.ext.args ?: ''
+    def prefix = task.ext.prefix ?: "${meta.id}"
+    def VERSION = '2.0.1'
+    def mature_species  = mature                ? "${mature}"              : "none"
+    def mature_other    = mature_other_species  ? "${mature_other_species}": "none"
+    def precursors      = hairpin               ? "${hairpin}"             : "none"
+
+    """
+    miRDeep2.pl \\
+        $processed_reads \\
+        $fasta \\
+        $genome_mappings \\
+        $mature_species \\
+        $mature_other \\
+        $precursors \\
+        $args
+
+    mv result_*.bed result_${prefix}.bed
+    mv result_*.csv result_${prefix}.csv
+    mv result_*.html result_${prefix}.html
+
+    cat <<-END_VERSIONS > versions.yml
+    "${task.process}":
+        mirdeep2: \$(echo "$VERSION")
+    END_VERSIONS
+    """
+
+    stub:
+    def args = task.ext.args ?: ''
+    def prefix = task.ext.prefix ?: "${meta.id}"
+    def VERSION = '2.0.1'
+    """
+    touch result_${prefix}.html
+    touch result_${prefix}.bed
+    touch result_${prefix}.csv
+
+    cat <<-END_VERSIONS > versions.yml
+    "${task.process}":
+        mirdeep2: \$(echo "$VERSION")
+    END_VERSIONS
+    """
+}