diff --git a/notebooks/TBCK/TBCK_IHPRF3_individuals.ipynb b/notebooks/TBCK/TBCK_IHPRF3_individuals.ipynb index 6fb997c29..a61c5f36c 100644 --- a/notebooks/TBCK/TBCK_IHPRF3_individuals.ipynb +++ b/notebooks/TBCK/TBCK_IHPRF3_individuals.ipynb @@ -10,27 +10,19 @@ }, { "cell_type": "code", - "execution_count": 1, + "execution_count": 9, "metadata": {}, "outputs": [ { "name": "stdout", "output_type": "stream", "text": [ - "Using pyphetools version 0.9.80\n" - ] - }, - { - "name": "stderr", - "output_type": "stream", - "text": [ - "/Users/robin/GIT/phenopacket-store/ps24venv/lib/python3.9/site-packages/urllib3/__init__.py:35: NotOpenSSLWarning: urllib3 v2 only supports OpenSSL 1.1.1+, currently the 'ssl' module is compiled with 'LibreSSL 2.8.3'. See: https://github.com/urllib3/urllib3/issues/3020\n", - " warnings.warn(\n" + "Using pyphetools version 0.9.108\n" ] } ], "source": [ - "from pyphetools.creation import TemplateImporter\n", + "from pyphetools.creation import TemplateImporter, Moi \n", "from pyphetools.visualization import IndividualTable, QcVisualizer\n", "from IPython.display import display, HTML\n", "import pyphetools\n", @@ -39,7 +31,7 @@ }, { "cell_type": "code", - "execution_count": 2, + "execution_count": 10, "metadata": {}, "outputs": [], "source": [ @@ -49,17 +41,19 @@ }, { "cell_type": "code", - "execution_count": 6, + "execution_count": 11, "metadata": {}, "outputs": [ { "name": "stdout", "output_type": "stream", "text": [ - "HPO version 2024-04-26\n", - "Created encoders for 77 fields\n", + "HPO version 2024-08-13\n", + "Created encoders for 91 fields\n", "Importing OMIM:616900, Hypotonia, infantile, with psychomotor retardation and characteristic facies 3, HGNC:28261, TBCK, NM_001163435.3\n", - "We output 23 GA4GH phenopackets to the directory phenopackets\n" + "[INFO] encoding variant \"c.490C>T\"\n", + "https://rest.variantvalidator.org/VariantValidator/variantvalidator/hg38/NM_001163435.3%3Ac.490C>T/NM_001163435.3?content-type=application%2Fjson\n", + "We output 27 GA4GH phenopackets to the directory phenopackets\n" ] } ], @@ -71,20 +65,20 @@ }, { "cell_type": "code", - "execution_count": 7, + "execution_count": 12, "metadata": {}, "outputs": [ { "data": { "text/html": [ "

Cohort validation

\n", - "

Errors found with 9 of 23 phenopackets.

\n", + "

Errors found with 12 of 27 phenopackets.

\n", "\n", "\n", "\n", - "\n", + "\n", "
Error counts
LevelError categoryCount
WARNINGREDUNDANT9
WARNINGREDUNDANT14
\n", - "

A total of 9 issues were fixed and no individual was removed from the cohort.

" + "

A total of 14 issues were fixed and no individual was removed from the cohort.

" ], "text/plain": [ "" @@ -101,38 +95,94 @@ }, { "cell_type": "code", - "execution_count": 8, + "execution_count": 13, "metadata": {}, "outputs": [ { "data": { "text/html": [ "\n", - "\n", + "\n", "\n", - "\n", - "\n", - "\n", - "\n", - "\n", - "\n", - "\n", - "\n", - "\n", - "\n", - "\n", - "\n", - "\n", - "\n", - "\n", - "\n", - "\n", - "\n", - "\n", - "\n", - "\n", - "\n", - "\n", + "\n", + "\n", + "\n", + "\n", + "\n", + "\n", + "\n", + "\n", + "\n", + "\n", + "\n", + "\n", + "\n", + "\n", + "\n", + "\n", + "\n", + "\n", + "\n", + "\n", + "\n", + "\n", + "\n", + "\n", + "\n", + "\n", + "\n", "
23 phenopackets - PMID:27040691 (n=13); PMID:27040692 (n=5); PMID:27275012 (n=3); PMID:30103036 (n=2)27 phenopackets - PMID:27040691 (n=13); PMID:27040692 (n=5); PMID:27275012 (n=3); PMID:30103036 (n=2); PMID:36273129 (n=1); PMID:32363625 (n=2); PMID:37876076 (n=1)
IndividualDiseaseGenotypePhenotypic features
Individual 1-1a (MALE; P5Y)Hypotonia, infantile, with psychomotor retardation and characteristic facies 3 (OMIM:616900)NM_001163435.3:c.1897+1G>A (homozygous)Sloping forehead (HP:0000340); Tented upper lip vermilion (HP:0010804); Upslanted palpebral fissure (HP:0000582); Bulbous nose (HP:0000414); Global brain atrophy (HP:0002283); Delayed speech and language development (HP:0000750); Motor delay (HP:0001270); Global developmental delay (HP:0001263); Hyporeflexia (HP:0001265); Seizure (HP:0001250); Hypotonia (HP:0001252); Decreased fetal movement (HP:0001558); Oligohydramnios (HP:0001562); excluded: Macroglossia (HP:0000158); excluded: Coarse facial features (HP:0000280); excluded: 11 pairs of ribs (HP:0000878); excluded: Long philtrum (HP:0000343); excluded: Epicanthus (HP:0000286); excluded: Mandibular prognathia (HP:0000303); excluded: Long eyelashes (HP:0000527); excluded: Synophrys (HP:0000664); excluded: Broad forehead (HP:0000337); excluded: Wide nasal bridge (HP:0000431); excluded: Open mouth (HP:0000194); excluded: Thick vermilion border (HP:0012471); excluded: Prominent metopic ridge (HP:0005487); excluded: Hirsutism (HP:0001007); excluded: Microcephaly (HP:0000252); excluded: Macrocephaly (HP:0000256); excluded: Short neck (HP:0000470); excluded: Corneal opacity (HP:0007957); excluded: Scoliosis (HP:0002650); excluded: Hearing impairment (HP:0000365); excluded: Periventricular leukomalacia (HP:0006970); excluded: Absent speech (HP:0001344); excluded: Developmental regression (HP:0002376); excluded: Deeply set eye (HP:0000490)
Individual 1-2a (FEMALE; P11Y)Hypotonia, infantile, with psychomotor retardation and characteristic facies 3 (OMIM:616900)NM_001163435.3:c.1897+1G>A (homozygous)Sloping forehead (HP:0000340); Tented upper lip vermilion (HP:0010804); Bulbous nose (HP:0000414); Periventricular leukomalacia (HP:0006970); Absent speech (HP:0001344); Motor delay (HP:0001270); Global developmental delay (HP:0001263); Hyporeflexia (HP:0001265); Seizure (HP:0001250); Hypotonia (HP:0001252); excluded: Macroglossia (HP:0000158); excluded: Coarse facial features (HP:0000280); excluded: 11 pairs of ribs (HP:0000878); excluded: Long philtrum (HP:0000343); excluded: Upslanted palpebral fissure (HP:0000582); excluded: Epicanthus (HP:0000286); excluded: Mandibular prognathia (HP:0000303); excluded: Long eyelashes (HP:0000527); excluded: Synophrys (HP:0000664); excluded: Broad forehead (HP:0000337); excluded: Wide nasal bridge (HP:0000431); excluded: Open mouth (HP:0000194); excluded: Thick vermilion border (HP:0012471); excluded: Prominent metopic ridge (HP:0005487); excluded: Hirsutism (HP:0001007); excluded: Microcephaly (HP:0000252); excluded: Macrocephaly (HP:0000256); excluded: Short neck (HP:0000470); excluded: Corneal opacity (HP:0007957); excluded: Scoliosis (HP:0002650); excluded: Hearing impairment (HP:0000365); excluded: Global brain atrophy (HP:0002283); excluded: Developmental regression (HP:0002376); excluded: Deeply set eye (HP:0000490); excluded: Decreased fetal movement (HP:0001558); excluded: Oligohydramnios (HP:0001562)
Individual 2-1 (MALE; P5Y)Hypotonia, infantile, with psychomotor retardation and characteristic facies 3 (OMIM:616900)NM_001163435.3:c.831_832insTA (homozygous)Macrocephaly (HP:0000256); Absent speech (HP:0001344); Motor delay (HP:0001270); Global developmental delay (HP:0001263); Hyporeflexia (HP:0001265); Seizure (HP:0001250); Hypotonia (HP:0001252); excluded: Macroglossia (HP:0000158); excluded: Coarse facial features (HP:0000280); excluded: Sloping forehead (HP:0000340); excluded: 11 pairs of ribs (HP:0000878); excluded: Long philtrum (HP:0000343); excluded: Tented upper lip vermilion (HP:0010804); excluded: Upslanted palpebral fissure (HP:0000582); excluded: Epicanthus (HP:0000286); excluded: Mandibular prognathia (HP:0000303); excluded: Long eyelashes (HP:0000527); excluded: Synophrys (HP:0000664); excluded: Broad forehead (HP:0000337); excluded: Wide nasal bridge (HP:0000431); excluded: Bulbous nose (HP:0000414); excluded: Open mouth (HP:0000194); excluded: Thick vermilion border (HP:0012471); excluded: Prominent metopic ridge (HP:0005487); excluded: Hirsutism (HP:0001007); excluded: Microcephaly (HP:0000252); excluded: Short neck (HP:0000470); excluded: Corneal opacity (HP:0007957); excluded: Scoliosis (HP:0002650); excluded: Hearing impairment (HP:0000365); excluded: Global brain atrophy (HP:0002283); excluded: Periventricular leukomalacia (HP:0006970); excluded: Developmental regression (HP:0002376); excluded: Deeply set eye (HP:0000490); excluded: Decreased fetal movement (HP:0001558); excluded: Oligohydramnios (HP:0001562)
Individual 3-1 (MALE; P11Y)Hypotonia, infantile, with psychomotor retardation and characteristic facies 3 (OMIM:616900)NM_001163435.3:c.1652T>C (homozygous)Epicanthus (HP:0000286); Wide nasal bridge (HP:0000431); Scoliosis (HP:0002650); Delayed speech and language development (HP:0000750); Motor delay (HP:0001270); Global developmental delay (HP:0001263); Deeply set eye (HP:0000490); Hypotonia (HP:0001252); excluded: Macroglossia (HP:0000158); excluded: Coarse facial features (HP:0000280); excluded: Sloping forehead (HP:0000340); excluded: 11 pairs of ribs (HP:0000878); excluded: Long philtrum (HP:0000343); excluded: Tented upper lip vermilion (HP:0010804); excluded: Upslanted palpebral fissure (HP:0000582); excluded: Mandibular prognathia (HP:0000303); excluded: Long eyelashes (HP:0000527); excluded: Synophrys (HP:0000664); excluded: Broad forehead (HP:0000337); excluded: Bulbous nose (HP:0000414); excluded: Open mouth (HP:0000194); excluded: Thick vermilion border (HP:0012471); excluded: Prominent metopic ridge (HP:0005487); excluded: Hirsutism (HP:0001007); excluded: Microcephaly (HP:0000252); excluded: Macrocephaly (HP:0000256); excluded: Short neck (HP:0000470); excluded: Corneal opacity (HP:0007957); excluded: Hearing impairment (HP:0000365); excluded: Global brain atrophy (HP:0002283); excluded: Periventricular leukomalacia (HP:0006970); excluded: Absent speech (HP:0001344); excluded: Developmental regression (HP:0002376); excluded: Hyporeflexia (HP:0001265); excluded: Seizure (HP:0001250); excluded: Decreased fetal movement (HP:0001558); excluded: Oligohydramnios (HP:0001562)
Individual 4-1 (FEMALE; P4Y)Hypotonia, infantile, with psychomotor retardation and characteristic facies 3 (OMIM:616900)
  • NM_001163435.3:c.2060-2A>G (heterozygous)
  • NM_001163435.3:c.803_806del (heterozygous)
Macrocephaly (HP:0000256); Delayed speech and language development (HP:0000750); Global developmental delay (HP:0001263); Hyporeflexia (HP:0001265); Hypotonia (HP:0001252); excluded: Macroglossia (HP:0000158); excluded: Coarse facial features (HP:0000280); excluded: Sloping forehead (HP:0000340); excluded: 11 pairs of ribs (HP:0000878); excluded: Long philtrum (HP:0000343); excluded: Tented upper lip vermilion (HP:0010804); excluded: Upslanted palpebral fissure (HP:0000582); excluded: Epicanthus (HP:0000286); excluded: Mandibular prognathia (HP:0000303); excluded: Long eyelashes (HP:0000527); excluded: Synophrys (HP:0000664); excluded: Broad forehead (HP:0000337); excluded: Wide nasal bridge (HP:0000431); excluded: Bulbous nose (HP:0000414); excluded: Open mouth (HP:0000194); excluded: Thick vermilion border (HP:0012471); excluded: Prominent metopic ridge (HP:0005487); excluded: Hirsutism (HP:0001007); excluded: Microcephaly (HP:0000252); excluded: Short neck (HP:0000470); excluded: Corneal opacity (HP:0007957); excluded: Scoliosis (HP:0002650); excluded: Hearing impairment (HP:0000365); excluded: Global brain atrophy (HP:0002283); excluded: Periventricular leukomalacia (HP:0006970); excluded: Absent speech (HP:0001344); excluded: Motor delay (HP:0001270); excluded: Developmental regression (HP:0002376); excluded: Seizure (HP:0001250); excluded: Deeply set eye (HP:0000490)
Individual 4-2 (FEMALE; P2Y)Hypotonia, infantile, with psychomotor retardation and characteristic facies 3 (OMIM:616900)
  • NM_001163435.3:c.2060-2A>G (heterozygous)
  • NM_001163435.3:c.803_806del (heterozygous)
Global brain atrophy (HP:0002283); Delayed speech and language development (HP:0000750); Motor delay (HP:0001270); Global developmental delay (HP:0001263); Hyporeflexia (HP:0001265); Hypotonia (HP:0001252); excluded: Macroglossia (HP:0000158); excluded: Coarse facial features (HP:0000280); excluded: Sloping forehead (HP:0000340); excluded: 11 pairs of ribs (HP:0000878); excluded: Long philtrum (HP:0000343); excluded: Tented upper lip vermilion (HP:0010804); excluded: Upslanted palpebral fissure (HP:0000582); excluded: Epicanthus (HP:0000286); excluded: Mandibular prognathia (HP:0000303); excluded: Long eyelashes (HP:0000527); excluded: Synophrys (HP:0000664); excluded: Broad forehead (HP:0000337); excluded: Wide nasal bridge (HP:0000431); excluded: Bulbous nose (HP:0000414); excluded: Open mouth (HP:0000194); excluded: Thick vermilion border (HP:0012471); excluded: Prominent metopic ridge (HP:0005487); excluded: Hirsutism (HP:0001007); excluded: Microcephaly (HP:0000252); excluded: Macrocephaly (HP:0000256); excluded: Short neck (HP:0000470); excluded: Corneal opacity (HP:0007957); excluded: Scoliosis (HP:0002650); excluded: Hearing impairment (HP:0000365); excluded: Periventricular leukomalacia (HP:0006970); excluded: Absent speech (HP:0001344); excluded: Developmental regression (HP:0002376); excluded: Seizure (HP:0001250); excluded: Deeply set eye (HP:0000490); excluded: Decreased fetal movement (HP:0001558); excluded: Oligohydramnios (HP:0001562)
Individual 5-1 (FEMALE; P10Y)Hypotonia, infantile, with psychomotor retardation and characteristic facies 3 (OMIM:616900)NM_001163435.3:c.376C>T (homozygous)Coarse facial features (HP:0000280); Long eyelashes (HP:0000527); Synophrys (HP:0000664); Hirsutism (HP:0001007); Microcephaly (HP:0000252); Corneal opacity (HP:0007957); Scoliosis (HP:0002650); Absent speech (HP:0001344); Motor delay (HP:0001270); Global developmental delay (HP:0001263); Developmental regression (HP:0002376); Hyporeflexia (HP:0001265); Seizure (HP:0001250); Hypotonia (HP:0001252); excluded: Macroglossia (HP:0000158); excluded: Sloping forehead (HP:0000340); excluded: 11 pairs of ribs (HP:0000878); excluded: Long philtrum (HP:0000343); excluded: Tented upper lip vermilion (HP:0010804); excluded: Upslanted palpebral fissure (HP:0000582); excluded: Epicanthus (HP:0000286); excluded: Mandibular prognathia (HP:0000303); excluded: Broad forehead (HP:0000337); excluded: Wide nasal bridge (HP:0000431); excluded: Bulbous nose (HP:0000414); excluded: Open mouth (HP:0000194); excluded: Thick vermilion border (HP:0012471); excluded: Prominent metopic ridge (HP:0005487); excluded: Macrocephaly (HP:0000256); excluded: Short neck (HP:0000470); excluded: Hearing impairment (HP:0000365); excluded: Global brain atrophy (HP:0002283); excluded: Periventricular leukomalacia (HP:0006970); excluded: Deeply set eye (HP:0000490); excluded: Decreased fetal movement (HP:0001558); excluded: Oligohydramnios (HP:0001562)
Individual 6-1 (MALE; P12Y)Hypotonia, infantile, with psychomotor retardation and characteristic facies 3 (OMIM:616900)NM_001163435.3:c.1370del (homozygous)Mandibular prognathia (HP:0000303); Broad forehead (HP:0000337); Bulbous nose (HP:0000414); Open mouth (HP:0000194); Thick vermilion border (HP:0012471); Delayed skeletal maturation (HP:0002750); Hearing impairment (HP:0000365); Absent speech (HP:0001344); Motor delay (HP:0001270); Global developmental delay (HP:0001263); Hypotonia (HP:0001252); excluded: Macroglossia (HP:0000158); excluded: Coarse facial features (HP:0000280); excluded: Sloping forehead (HP:0000340); excluded: 11 pairs of ribs (HP:0000878); excluded: Long philtrum (HP:0000343); excluded: Tented upper lip vermilion (HP:0010804); excluded: Upslanted palpebral fissure (HP:0000582); excluded: Epicanthus (HP:0000286); excluded: Long eyelashes (HP:0000527); excluded: Synophrys (HP:0000664); excluded: Wide nasal bridge (HP:0000431); excluded: Prominent metopic ridge (HP:0005487); excluded: Hirsutism (HP:0001007); excluded: Microcephaly (HP:0000252); excluded: Macrocephaly (HP:0000256); excluded: Short neck (HP:0000470); excluded: Corneal opacity (HP:0007957); excluded: Scoliosis (HP:0002650); excluded: Global brain atrophy (HP:0002283); excluded: Periventricular leukomalacia (HP:0006970); excluded: Developmental regression (HP:0002376); excluded: Hyporeflexia (HP:0001265); excluded: Seizure (HP:0001250); excluded: Deeply set eye (HP:0000490); excluded: Decreased fetal movement (HP:0001558); excluded: Oligohydramnios (HP:0001562)
Individual 6-2 (FEMALE; P3Y)Hypotonia, infantile, with psychomotor retardation and characteristic facies 3 (OMIM:616900)NM_001163435.3:c.1370del (homozygous)Broad forehead (HP:0000337); Macrocephaly (HP:0000256); Short neck (HP:0000470); Delayed skeletal maturation (HP:0002750); Delayed speech and language development (HP:0000750); Motor delay (HP:0001270); Global developmental delay (HP:0001263); Hypotonia (HP:0001252); excluded: Macroglossia (HP:0000158); excluded: Coarse facial features (HP:0000280); excluded: Sloping forehead (HP:0000340); excluded: 11 pairs of ribs (HP:0000878); excluded: Long philtrum (HP:0000343); excluded: Tented upper lip vermilion (HP:0010804); excluded: Upslanted palpebral fissure (HP:0000582); excluded: Epicanthus (HP:0000286); excluded: Mandibular prognathia (HP:0000303); excluded: Long eyelashes (HP:0000527); excluded: Synophrys (HP:0000664); excluded: Wide nasal bridge (HP:0000431); excluded: Bulbous nose (HP:0000414); excluded: Open mouth (HP:0000194); excluded: Thick vermilion border (HP:0012471); excluded: Prominent metopic ridge (HP:0005487); excluded: Hirsutism (HP:0001007); excluded: Microcephaly (HP:0000252); excluded: Corneal opacity (HP:0007957); excluded: Scoliosis (HP:0002650); excluded: Hearing impairment (HP:0000365); excluded: Global brain atrophy (HP:0002283); excluded: Periventricular leukomalacia (HP:0006970); excluded: Absent speech (HP:0001344); excluded: Developmental regression (HP:0002376); excluded: Hyporeflexia (HP:0001265); excluded: Seizure (HP:0001250); excluded: Deeply set eye (HP:0000490); excluded: Decreased fetal movement (HP:0001558); excluded: Oligohydramnios (HP:0001562)
Individual 7-1 (MALE; P6Y)Hypotonia, infantile, with psychomotor retardation and characteristic facies 3 (OMIM:616900)NM_001163435.3:c.455+4A>G (homozygous)Delayed speech and language development (HP:0000750); Motor delay (HP:0001270); Global developmental delay (HP:0001263); Hyporeflexia (HP:0001265); Hypotonia (HP:0001252); excluded: Macroglossia (HP:0000158); excluded: Coarse facial features (HP:0000280); excluded: Sloping forehead (HP:0000340); excluded: 11 pairs of ribs (HP:0000878); excluded: Long philtrum (HP:0000343); excluded: Tented upper lip vermilion (HP:0010804); excluded: Upslanted palpebral fissure (HP:0000582); excluded: Epicanthus (HP:0000286); excluded: Mandibular prognathia (HP:0000303); excluded: Long eyelashes (HP:0000527); excluded: Synophrys (HP:0000664); excluded: Broad forehead (HP:0000337); excluded: Wide nasal bridge (HP:0000431); excluded: Bulbous nose (HP:0000414); excluded: Open mouth (HP:0000194); excluded: Thick vermilion border (HP:0012471); excluded: Prominent metopic ridge (HP:0005487); excluded: Hirsutism (HP:0001007); excluded: Microcephaly (HP:0000252); excluded: Macrocephaly (HP:0000256); excluded: Short neck (HP:0000470); excluded: Corneal opacity (HP:0007957); excluded: Scoliosis (HP:0002650); excluded: Hearing impairment (HP:0000365); excluded: Global brain atrophy (HP:0002283); excluded: Periventricular leukomalacia (HP:0006970); excluded: Absent speech (HP:0001344); excluded: Developmental regression (HP:0002376); excluded: Seizure (HP:0001250); excluded: Deeply set eye (HP:0000490); excluded: Decreased fetal movement (HP:0001558); excluded: Oligohydramnios (HP:0001562)
Individual 8-1 (FEMALE; P12Y)Hypotonia, infantile, with psychomotor retardation and characteristic facies 3 (OMIM:616900)NM_001163435.3:c.376C>T (homozygous)Macroglossia (HP:0000158); Coarse facial features (HP:0000280); Macrocephaly (HP:0000256); Scoliosis (HP:0002650); Absent speech (HP:0001344); Motor delay (HP:0001270); Global developmental delay (HP:0001263); Hyporeflexia (HP:0001265); Seizure (HP:0001250); Hypotonia (HP:0001252); excluded: Sloping forehead (HP:0000340); excluded: 11 pairs of ribs (HP:0000878); excluded: Long philtrum (HP:0000343); excluded: Tented upper lip vermilion (HP:0010804); excluded: Upslanted palpebral fissure (HP:0000582); excluded: Epicanthus (HP:0000286); excluded: Mandibular prognathia (HP:0000303); excluded: Long eyelashes (HP:0000527); excluded: Synophrys (HP:0000664); excluded: Broad forehead (HP:0000337); excluded: Wide nasal bridge (HP:0000431); excluded: Bulbous nose (HP:0000414); excluded: Open mouth (HP:0000194); excluded: Thick vermilion border (HP:0012471); excluded: Prominent metopic ridge (HP:0005487); excluded: Hirsutism (HP:0001007); excluded: Microcephaly (HP:0000252); excluded: Short neck (HP:0000470); excluded: Corneal opacity (HP:0007957); excluded: Hearing impairment (HP:0000365); excluded: Global brain atrophy (HP:0002283); excluded: Periventricular leukomalacia (HP:0006970); excluded: Developmental regression (HP:0002376); excluded: Deeply set eye (HP:0000490); excluded: Decreased fetal movement (HP:0001558); excluded: Oligohydramnios (HP:0001562)
Individual 9-1 (FEMALE; P10Y)Hypotonia, infantile, with psychomotor retardation and characteristic facies 3 (OMIM:616900)
  • DELc.(658observed1_ 659-1)_ (2059observed1_2060-1del: chromosomal_deletion (SO:1000029)
  • NM_001163435.3:c.376C>T (heterozygous)
Prominent metopic ridge (HP:0005487); Absent speech (HP:0001344); Motor delay (HP:0001270); Global developmental delay (HP:0001263); Hypotonia (HP:0001252); excluded: Macroglossia (HP:0000158); excluded: Coarse facial features (HP:0000280); excluded: Sloping forehead (HP:0000340); excluded: 11 pairs of ribs (HP:0000878); excluded: Long philtrum (HP:0000343); excluded: Tented upper lip vermilion (HP:0010804); excluded: Upslanted palpebral fissure (HP:0000582); excluded: Epicanthus (HP:0000286); excluded: Mandibular prognathia (HP:0000303); excluded: Long eyelashes (HP:0000527); excluded: Synophrys (HP:0000664); excluded: Broad forehead (HP:0000337); excluded: Wide nasal bridge (HP:0000431); excluded: Bulbous nose (HP:0000414); excluded: Open mouth (HP:0000194); excluded: Thick vermilion border (HP:0012471); excluded: Hirsutism (HP:0001007); excluded: Microcephaly (HP:0000252); excluded: Macrocephaly (HP:0000256); excluded: Short neck (HP:0000470); excluded: Corneal opacity (HP:0007957); excluded: Scoliosis (HP:0002650); excluded: Hearing impairment (HP:0000365); excluded: Global brain atrophy (HP:0002283); excluded: Periventricular leukomalacia (HP:0006970); excluded: Developmental regression (HP:0002376); excluded: Seizure (HP:0001250); excluded: Deeply set eye (HP:0000490)
Individual 9-2 (MALE; P2Y)Hypotonia, infantile, with psychomotor retardation and characteristic facies 3 (OMIM:616900)
  • DELc.(658observed1_ 659-1)_ (2059observed1_2060-1del: chromosomal_deletion (SO:1000029)
  • NM_001163435.3:c.376C>T (heterozygous)
Coarse facial features (HP:0000280); 11 pairs of ribs (HP:0000878); Long philtrum (HP:0000343); Tented upper lip vermilion (HP:0010804); Epicanthus (HP:0000286); Hirsutism (HP:0001007); Absent speech (HP:0001344); Motor delay (HP:0001270); Global developmental delay (HP:0001263); Hypotonia (HP:0001252); excluded: Macroglossia (HP:0000158); excluded: Sloping forehead (HP:0000340); excluded: Upslanted palpebral fissure (HP:0000582); excluded: Mandibular prognathia (HP:0000303); excluded: Long eyelashes (HP:0000527); excluded: Synophrys (HP:0000664); excluded: Broad forehead (HP:0000337); excluded: Wide nasal bridge (HP:0000431); excluded: Bulbous nose (HP:0000414); excluded: Open mouth (HP:0000194); excluded: Thick vermilion border (HP:0012471); excluded: Prominent metopic ridge (HP:0005487); excluded: Microcephaly (HP:0000252); excluded: Macrocephaly (HP:0000256); excluded: Short neck (HP:0000470); excluded: Corneal opacity (HP:0007957); excluded: Scoliosis (HP:0002650); excluded: Hearing impairment (HP:0000365); excluded: Global brain atrophy (HP:0002283); excluded: Periventricular leukomalacia (HP:0006970); excluded: Developmental regression (HP:0002376); excluded: Seizure (HP:0001250); excluded: Deeply set eye (HP:0000490); excluded: Decreased fetal movement (HP:0001558); excluded: Oligohydramnios (HP:0001562)
A-II-1 (MALE; P14Y)Hypotonia, infantile, with psychomotor retardation and characteristic facies 3 (OMIM:616900)NM_001163435.3:c.376C>T (homozygous)P2Y6M: Seizure (HP:0001250)
Macroglossia (HP:0000158); Gingival overgrowth (HP:0000212); Coarse facial features (HP:0000280); Highly arched eyebrow (HP:0002553); Prominent nasal bridge (HP:0000426); Exaggerated cupid's bow (HP:0002263); Anteverted nares (HP:0000463); Narrow forehead (HP:0000341); Global developmental delay (HP:0001263); Developmental regression (HP:0002376); Hyporeflexia (HP:0001265); Hypotonia (HP:0001252); Cerebral visual impairment (HP:0100704); Ptosis (HP:0000508); Cataract (HP:0000518); Respiratory insufficiency (HP:0002093); Tube feeding (HP:0033454); Osteoporosis (HP:0000939); excluded: 11 pairs of ribs (HP:0000878); excluded: Hearing impairment (HP:0000365); excluded: Deeply set eye (HP:0000490); excluded: Esotropia (HP:0000565); excluded: Right aortic arch (HP:0012020)
B-IV-4 (FEMALE; P4Y)Hypotonia, infantile, with psychomotor retardation and characteristic facies 3 (OMIM:616900)NM_001163435.3:c.1363A>T (homozygous)P2Y1M: Seizure (HP:0001250)
Gingival overgrowth (HP:0000212); Highly arched eyebrow (HP:0002553); Prominent nasal bridge (HP:0000426); Exaggerated cupid's bow (HP:0002263); Anteverted nares (HP:0000463); Narrow forehead (HP:0000341); Global developmental delay (HP:0001263); Developmental regression (HP:0002376); Hyporeflexia (HP:0001265); Deeply set eye (HP:0000490); Hypotonia (HP:0001252); Cerebral visual impairment (HP:0100704); Respiratory insufficiency (HP:0002093); Tube feeding (HP:0033454); Osteoporosis (HP:0000939); excluded: Macroglossia (HP:0000158); excluded: Coarse facial features (HP:0000280); excluded: 11 pairs of ribs (HP:0000878); excluded: Hearing impairment (HP:0000365); excluded: Ptosis (HP:0000508); excluded: Cataract (HP:0000518); excluded: Esotropia (HP:0000565); excluded: Right aortic arch (HP:0012020)
B-IV-6 (FEMALE; P10Y)Hypotonia, infantile, with psychomotor retardation and characteristic facies 3 (OMIM:616900)NM_001163435.3:c.1363A>T (homozygous)P6Y: Seizure (HP:0001250)
Highly arched eyebrow (HP:0002553); Prominent nasal bridge (HP:0000426); Exaggerated cupid's bow (HP:0002263); Anteverted nares (HP:0000463); Narrow forehead (HP:0000341); Global developmental delay (HP:0001263); Developmental regression (HP:0002376); Deeply set eye (HP:0000490); Hypotonia (HP:0001252); Respiratory insufficiency (HP:0002093); Tube feeding (HP:0033454); Osteoporosis (HP:0000939); excluded: Macroglossia (HP:0000158); excluded: Coarse facial features (HP:0000280); excluded: 11 pairs of ribs (HP:0000878); excluded: Hearing impairment (HP:0000365); excluded: Cerebral visual impairment (HP:0100704); excluded: Ptosis (HP:0000508); excluded: Cataract (HP:0000518); excluded: Esotropia (HP:0000565); excluded: Right aortic arch (HP:0012020)
C-II-1 (MALE; P2Y)Hypotonia, infantile, with psychomotor retardation and characteristic facies 3 (OMIM:616900)NM_001163435.3:c.1532G>A (homozygous)Coarse facial features (HP:0000280); 11 pairs of ribs (HP:0000878); Prominent nasal bridge (HP:0000426); Exaggerated cupid's bow (HP:0002263); Anteverted nares (HP:0000463); Narrow forehead (HP:0000341); Global developmental delay (HP:0001263); Hyporeflexia (HP:0001265); Hypotonia (HP:0001252); Esotropia (HP:0000565); Tube feeding (HP:0033454); Right aortic arch (HP:0012020); excluded: Macroglossia (HP:0000158); excluded: Highly arched eyebrow (HP:0002553); excluded: Hearing impairment (HP:0000365); excluded: Developmental regression (HP:0002376); excluded: Seizure (HP:0001250); excluded: Deeply set eye (HP:0000490); excluded: Cerebral visual impairment (HP:0100704); excluded: Ptosis (HP:0000508); excluded: Cataract (HP:0000518); excluded: Respiratory insufficiency (HP:0002093); excluded: Osteoporosis (HP:0000939)
D-II-1 (MALE; P14Y)Hypotonia, infantile, with psychomotor retardation and characteristic facies 3 (OMIM:616900)NM_001163435.3:c.376C>T (homozygous)P1Y3M: Seizure (HP:0001250)
Macroglossia (HP:0000158); Coarse facial features (HP:0000280); Highly arched eyebrow (HP:0002553); Prominent nasal bridge (HP:0000426); Exaggerated cupid's bow (HP:0002263); Narrow forehead (HP:0000341); Global developmental delay (HP:0001263); Developmental regression (HP:0002376); Hyporeflexia (HP:0001265); Deeply set eye (HP:0000490); Hypotonia (HP:0001252); Cerebral visual impairment (HP:0100704); Respiratory insufficiency (HP:0002093); Tube feeding (HP:0033454); Osteoporosis (HP:0000939); excluded: Gingival overgrowth (HP:0000212); excluded: 11 pairs of ribs (HP:0000878); excluded: Anteverted nares (HP:0000463); excluded: Hearing impairment (HP:0000365); excluded: Ptosis (HP:0000508); excluded: Cataract (HP:0000518); excluded: Esotropia (HP:0000565); excluded: Right aortic arch (HP:0012020)
Patient 1 (MALE; P9Y)Hypotonia, infantile, with psychomotor retardation and characteristic facies 3 (OMIM:616900)NM_001163435.3:c.614_617del (homozygous)P9M: Seizure (HP:0001250)
Brachycephaly (HP:0000248); Motor delay (HP:0001270); Global developmental delay (HP:0001263); Hypotonia (HP:0001252); Cerebral visual impairment (HP:0100704); Strabismus (HP:0000486); Proptosis (HP:0000520); Single transverse palmar crease (HP:0000954); Overlapping toe (HP:0001845); excluded: Cerebellar atrophy (HP:0001272)
Patient 2 (MALE; P16Y)Hypotonia, infantile, with psychomotor retardation and characteristic facies 3 (OMIM:616900)NM_001163435.3:c.614_617del (homozygous)P2Y11M: Seizure (HP:0001250)
Brachycephaly (HP:0000248); Motor delay (HP:0001270); Global developmental delay (HP:0001263); Hypotonia (HP:0001252); Strabismus (HP:0000486); Proptosis (HP:0000520); Single transverse palmar crease (HP:0000954); Overlapping toe (HP:0001845); excluded: Cerebellar atrophy (HP:0001272)
Patient 3 (FEMALE; P11Y)Hypotonia, infantile, with psychomotor retardation and characteristic facies 3 (OMIM:616900)NM_001163435.3:c.614_617del (homozygous)P1Y6M: Seizure (HP:0001250)
Brachycephaly (HP:0000248); Cerebellar atrophy (HP:0001272); Global developmental delay (HP:0001263); Hypotonia (HP:0001252); Strabismus (HP:0000486); Proptosis (HP:0000520); Single transverse palmar crease (HP:0000954); Overlapping toe (HP:0001845)
Patient 1 (FEMALE; P5Y)Hypotonia, infantile, with psychomotor retardation and characteristic facies 3 (OMIM:616900)NM_001163435.3:c.753dup (homozygous)P2Y: Seizure (HP:0001250)
Long philtrum (HP:0000343); Open mouth (HP:0000194); Brachycephaly (HP:0000248); Absent speech (HP:0001344); Motor delay (HP:0001270); Global developmental delay (HP:0001263); EMG: myokymic discharges (HP:0100288); Deeply set eye (HP:0000490); Hypotonia (HP:0001252); excluded: Narrow forehead (HP:0000341); excluded: Macrocephaly (HP:0000256); excluded: Scoliosis (HP:0002650); excluded: Strabismus (HP:0000486); excluded: Respiratory insufficiency (HP:0002093)
Patient 2 (FEMALE; P3Y)Hypotonia, infantile, with psychomotor retardation and characteristic facies 3 (OMIM:616900)NM_001163435.3:c.753dup (homozygous)Long philtrum (HP:0000343); Open mouth (HP:0000194); Brachycephaly (HP:0000248); Absent speech (HP:0001344); Motor delay (HP:0001270); Global developmental delay (HP:0001263); Deeply set eye (HP:0000490); Hypotonia (HP:0001252); Strabismus (HP:0000486); excluded: Narrow forehead (HP:0000341); excluded: Macrocephaly (HP:0000256); excluded: Scoliosis (HP:0002650); excluded: EMG: myokymic discharges (HP:0100288); excluded: Status epilepticus (HP:0002133); excluded: Respiratory insufficiency (HP:0002093)
Individual 1-1a (MALE; P5Y)Hypotonia, infantile, with psychomotor retardation and characteristic facies 3 (OMIM:616900)NM_001163435.3:c.1897+1G>A (homozygous)Sloping forehead (HP:0000340): onset ; Tented upper lip vermilion (HP:0010804): onset ; Upslanted palpebral fissure (HP:0000582): onset ; Bulbous nose (HP:0000414): onset ; Global brain atrophy (HP:0002283): onset ; Delayed speech and language development (HP:0000750): onset ; Motor delay (HP:0001270): onset ; Global developmental delay (HP:0001263): onset ; Hyporeflexia (HP:0001265): onset ; Seizure (HP:0001250): onset ; Hypotonia (HP:0001252): onset ; Decreased fetal movement (HP:0001558): onset ; Oligohydramnios (HP:0001562): onset ; excluded: Macroglossia (HP:0000158): onset ; excluded: Coarse facial features (HP:0000280): onset ; excluded: 11 pairs of ribs (HP:0000878): onset ; excluded: Long philtrum (HP:0000343): onset ; excluded: Epicanthus (HP:0000286): onset ; excluded: Mandibular prognathia (HP:0000303): onset ; excluded: Long eyelashes (HP:0000527): onset ; excluded: Synophrys (HP:0000664): onset ; excluded: Broad forehead (HP:0000337): onset ; excluded: Wide nasal bridge (HP:0000431): onset ; excluded: Open mouth (HP:0000194): onset ; excluded: Thick vermilion border (HP:0012471): onset ; excluded: Prominent metopic ridge (HP:0005487): onset ; excluded: Hirsutism (HP:0001007): onset ; excluded: Microcephaly (HP:0000252): onset ; excluded: Macrocephaly (HP:0000256): onset ; excluded: Short neck (HP:0000470): onset ; excluded: Corneal opacity (HP:0007957): onset ; excluded: Scoliosis (HP:0002650): onset ; excluded: Hearing impairment (HP:0000365): onset ; excluded: Periventricular leukomalacia (HP:0006970): onset ; excluded: Absent speech (HP:0001344): onset ; excluded: Developmental regression (HP:0002376): onset ; excluded: Deeply set eye (HP:0000490): onset
Individual 1-2a (FEMALE; P11Y)Hypotonia, infantile, with psychomotor retardation and characteristic facies 3 (OMIM:616900)NM_001163435.3:c.1897+1G>A (homozygous)Sloping forehead (HP:0000340): onset ; Tented upper lip vermilion (HP:0010804): onset ; Bulbous nose (HP:0000414): onset ; Periventricular leukomalacia (HP:0006970): onset ; Absent speech (HP:0001344): onset ; Motor delay (HP:0001270): onset ; Global developmental delay (HP:0001263): onset ; Hyporeflexia (HP:0001265): onset ; Seizure (HP:0001250): onset ; Hypotonia (HP:0001252): onset ; excluded: Macroglossia (HP:0000158): onset ; excluded: Coarse facial features (HP:0000280): onset ; excluded: 11 pairs of ribs (HP:0000878): onset ; excluded: Long philtrum (HP:0000343): onset ; excluded: Upslanted palpebral fissure (HP:0000582): onset ; excluded: Epicanthus (HP:0000286): onset ; excluded: Mandibular prognathia (HP:0000303): onset ; excluded: Long eyelashes (HP:0000527): onset ; excluded: Synophrys (HP:0000664): onset ; excluded: Broad forehead (HP:0000337): onset ; excluded: Wide nasal bridge (HP:0000431): onset ; excluded: Open mouth (HP:0000194): onset ; excluded: Thick vermilion border (HP:0012471): onset ; excluded: Prominent metopic ridge (HP:0005487): onset ; excluded: Hirsutism (HP:0001007): onset ; excluded: Microcephaly (HP:0000252): onset ; excluded: Macrocephaly (HP:0000256): onset ; excluded: Short neck (HP:0000470): onset ; excluded: Corneal opacity (HP:0007957): onset ; excluded: Scoliosis (HP:0002650): onset ; excluded: Hearing impairment (HP:0000365): onset ; excluded: Global brain atrophy (HP:0002283): onset ; excluded: Developmental regression (HP:0002376): onset ; excluded: Deeply set eye (HP:0000490): onset ; excluded: Decreased fetal movement (HP:0001558): onset ; excluded: Oligohydramnios (HP:0001562): onset
Individual 2-1 (MALE; P5Y)Hypotonia, infantile, with psychomotor retardation and characteristic facies 3 (OMIM:616900)NM_001163435.3:c.831_832insTA (homozygous)Macrocephaly (HP:0000256): onset ; Absent speech (HP:0001344): onset ; Motor delay (HP:0001270): onset ; Global developmental delay (HP:0001263): onset ; Hyporeflexia (HP:0001265): onset ; Seizure (HP:0001250): onset ; Hypotonia (HP:0001252): onset ; excluded: Macroglossia (HP:0000158): onset ; excluded: Coarse facial features (HP:0000280): onset ; excluded: Sloping forehead (HP:0000340): onset ; excluded: 11 pairs of ribs (HP:0000878): onset ; excluded: Long philtrum (HP:0000343): onset ; excluded: Tented upper lip vermilion (HP:0010804): onset ; excluded: Upslanted palpebral fissure (HP:0000582): onset ; excluded: Epicanthus (HP:0000286): onset ; excluded: Mandibular prognathia (HP:0000303): onset ; excluded: Long eyelashes (HP:0000527): onset ; excluded: Synophrys (HP:0000664): onset ; excluded: Broad forehead (HP:0000337): onset ; excluded: Wide nasal bridge (HP:0000431): onset ; excluded: Bulbous nose (HP:0000414): onset ; excluded: Open mouth (HP:0000194): onset ; excluded: Thick vermilion border (HP:0012471): onset ; excluded: Prominent metopic ridge (HP:0005487): onset ; excluded: Hirsutism (HP:0001007): onset ; excluded: Microcephaly (HP:0000252): onset ; excluded: Short neck (HP:0000470): onset ; excluded: Corneal opacity (HP:0007957): onset ; excluded: Scoliosis (HP:0002650): onset ; excluded: Hearing impairment (HP:0000365): onset ; excluded: Global brain atrophy (HP:0002283): onset ; excluded: Periventricular leukomalacia (HP:0006970): onset ; excluded: Developmental regression (HP:0002376): onset ; excluded: Deeply set eye (HP:0000490): onset ; excluded: Decreased fetal movement (HP:0001558): onset ; excluded: Oligohydramnios (HP:0001562): onset
Individual 3-1 (MALE; P11Y)Hypotonia, infantile, with psychomotor retardation and characteristic facies 3 (OMIM:616900)NM_001163435.3:c.1652T>C (homozygous)Epicanthus (HP:0000286): onset ; Wide nasal bridge (HP:0000431): onset ; Scoliosis (HP:0002650): onset ; Delayed speech and language development (HP:0000750): onset ; Motor delay (HP:0001270): onset ; Global developmental delay (HP:0001263): onset ; Deeply set eye (HP:0000490): onset ; Hypotonia (HP:0001252): onset ; excluded: Macroglossia (HP:0000158): onset ; excluded: Coarse facial features (HP:0000280): onset ; excluded: Sloping forehead (HP:0000340): onset ; excluded: 11 pairs of ribs (HP:0000878): onset ; excluded: Long philtrum (HP:0000343): onset ; excluded: Tented upper lip vermilion (HP:0010804): onset ; excluded: Upslanted palpebral fissure (HP:0000582): onset ; excluded: Mandibular prognathia (HP:0000303): onset ; excluded: Long eyelashes (HP:0000527): onset ; excluded: Synophrys (HP:0000664): onset ; excluded: Broad forehead (HP:0000337): onset ; excluded: Bulbous nose (HP:0000414): onset ; excluded: Open mouth (HP:0000194): onset ; excluded: Thick vermilion border (HP:0012471): onset ; excluded: Prominent metopic ridge (HP:0005487): onset ; excluded: Hirsutism (HP:0001007): onset ; excluded: Microcephaly (HP:0000252): onset ; excluded: Macrocephaly (HP:0000256): onset ; excluded: Short neck (HP:0000470): onset ; excluded: Corneal opacity (HP:0007957): onset ; excluded: Hearing impairment (HP:0000365): onset ; excluded: Global brain atrophy (HP:0002283): onset ; excluded: Periventricular leukomalacia (HP:0006970): onset ; excluded: Absent speech (HP:0001344): onset ; excluded: Developmental regression (HP:0002376): onset ; excluded: Hyporeflexia (HP:0001265): onset ; excluded: Seizure (HP:0001250): onset ; excluded: Decreased fetal movement (HP:0001558): onset ; excluded: Oligohydramnios (HP:0001562): onset
Individual 4-1 (FEMALE; P4Y)Hypotonia, infantile, with psychomotor retardation and characteristic facies 3 (OMIM:616900)
  • NM_001163435.3:c.2060-2A>G (heterozygous)
  • NM_001163435.3:c.803_806del (heterozygous)
Macrocephaly (HP:0000256): onset ; Delayed speech and language development (HP:0000750): onset ; Global developmental delay (HP:0001263): onset ; Hyporeflexia (HP:0001265): onset ; Hypotonia (HP:0001252): onset ; excluded: Macroglossia (HP:0000158): onset ; excluded: Coarse facial features (HP:0000280): onset ; excluded: Sloping forehead (HP:0000340): onset ; excluded: 11 pairs of ribs (HP:0000878): onset ; excluded: Long philtrum (HP:0000343): onset ; excluded: Tented upper lip vermilion (HP:0010804): onset ; excluded: Upslanted palpebral fissure (HP:0000582): onset ; excluded: Epicanthus (HP:0000286): onset ; excluded: Mandibular prognathia (HP:0000303): onset ; excluded: Long eyelashes (HP:0000527): onset ; excluded: Synophrys (HP:0000664): onset ; excluded: Broad forehead (HP:0000337): onset ; excluded: Wide nasal bridge (HP:0000431): onset ; excluded: Bulbous nose (HP:0000414): onset ; excluded: Open mouth (HP:0000194): onset ; excluded: Thick vermilion border (HP:0012471): onset ; excluded: Prominent metopic ridge (HP:0005487): onset ; excluded: Hirsutism (HP:0001007): onset ; excluded: Microcephaly (HP:0000252): onset ; excluded: Short neck (HP:0000470): onset ; excluded: Corneal opacity (HP:0007957): onset ; excluded: Scoliosis (HP:0002650): onset ; excluded: Hearing impairment (HP:0000365): onset ; excluded: Global brain atrophy (HP:0002283): onset ; excluded: Periventricular leukomalacia (HP:0006970): onset ; excluded: Absent speech (HP:0001344): onset ; excluded: Motor delay (HP:0001270): onset ; excluded: Developmental regression (HP:0002376): onset ; excluded: Seizure (HP:0001250): onset ; excluded: Deeply set eye (HP:0000490): onset
Individual 4-2 (FEMALE; P2Y)Hypotonia, infantile, with psychomotor retardation and characteristic facies 3 (OMIM:616900)
  • NM_001163435.3:c.2060-2A>G (heterozygous)
  • NM_001163435.3:c.803_806del (heterozygous)
Global brain atrophy (HP:0002283): onset ; Delayed speech and language development (HP:0000750): onset ; Motor delay (HP:0001270): onset ; Global developmental delay (HP:0001263): onset ; Hyporeflexia (HP:0001265): onset ; Hypotonia (HP:0001252): onset ; excluded: Macroglossia (HP:0000158): onset ; excluded: Coarse facial features (HP:0000280): onset ; excluded: Sloping forehead (HP:0000340): onset ; excluded: 11 pairs of ribs (HP:0000878): onset ; excluded: Long philtrum (HP:0000343): onset ; excluded: Tented upper lip vermilion (HP:0010804): onset ; excluded: Upslanted palpebral fissure (HP:0000582): onset ; excluded: Epicanthus (HP:0000286): onset ; excluded: Mandibular prognathia (HP:0000303): onset ; excluded: Long eyelashes (HP:0000527): onset ; excluded: Synophrys (HP:0000664): onset ; excluded: Broad forehead (HP:0000337): onset ; excluded: Wide nasal bridge (HP:0000431): onset ; excluded: Bulbous nose (HP:0000414): onset ; excluded: Open mouth (HP:0000194): onset ; excluded: Thick vermilion border (HP:0012471): onset ; excluded: Prominent metopic ridge (HP:0005487): onset ; excluded: Hirsutism (HP:0001007): onset ; excluded: Microcephaly (HP:0000252): onset ; excluded: Macrocephaly (HP:0000256): onset ; excluded: Short neck (HP:0000470): onset ; excluded: Corneal opacity (HP:0007957): onset ; excluded: Scoliosis (HP:0002650): onset ; excluded: Hearing impairment (HP:0000365): onset ; excluded: Periventricular leukomalacia (HP:0006970): onset ; excluded: Absent speech (HP:0001344): onset ; excluded: Developmental regression (HP:0002376): onset ; excluded: Seizure (HP:0001250): onset ; excluded: Deeply set eye (HP:0000490): onset ; excluded: Decreased fetal movement (HP:0001558): onset ; excluded: Oligohydramnios (HP:0001562): onset
Individual 5-1 (FEMALE; P10Y)Hypotonia, infantile, with psychomotor retardation and characteristic facies 3 (OMIM:616900)NM_001163435.3:c.376C>T (homozygous)Coarse facial features (HP:0000280): onset ; Long eyelashes (HP:0000527): onset ; Synophrys (HP:0000664): onset ; Hirsutism (HP:0001007): onset ; Microcephaly (HP:0000252): onset ; Corneal opacity (HP:0007957): onset ; Scoliosis (HP:0002650): onset ; Absent speech (HP:0001344): onset ; Motor delay (HP:0001270): onset ; Global developmental delay (HP:0001263): onset ; Developmental regression (HP:0002376): onset ; Hyporeflexia (HP:0001265): onset ; Seizure (HP:0001250): onset ; Hypotonia (HP:0001252): onset ; excluded: Macroglossia (HP:0000158): onset ; excluded: Sloping forehead (HP:0000340): onset ; excluded: 11 pairs of ribs (HP:0000878): onset ; excluded: Long philtrum (HP:0000343): onset ; excluded: Tented upper lip vermilion (HP:0010804): onset ; excluded: Upslanted palpebral fissure (HP:0000582): onset ; excluded: Epicanthus (HP:0000286): onset ; excluded: Mandibular prognathia (HP:0000303): onset ; excluded: Broad forehead (HP:0000337): onset ; excluded: Wide nasal bridge (HP:0000431): onset ; excluded: Bulbous nose (HP:0000414): onset ; excluded: Open mouth (HP:0000194): onset ; excluded: Thick vermilion border (HP:0012471): onset ; excluded: Prominent metopic ridge (HP:0005487): onset ; excluded: Macrocephaly (HP:0000256): onset ; excluded: Short neck (HP:0000470): onset ; excluded: Hearing impairment (HP:0000365): onset ; excluded: Global brain atrophy (HP:0002283): onset ; excluded: Periventricular leukomalacia (HP:0006970): onset ; excluded: Deeply set eye (HP:0000490): onset ; excluded: Decreased fetal movement (HP:0001558): onset ; excluded: Oligohydramnios (HP:0001562): onset
Individual 6-1 (MALE; P12Y)Hypotonia, infantile, with psychomotor retardation and characteristic facies 3 (OMIM:616900)NM_001163435.3:c.1370del (homozygous)Mandibular prognathia (HP:0000303): onset ; Broad forehead (HP:0000337): onset ; Bulbous nose (HP:0000414): onset ; Open mouth (HP:0000194): onset ; Thick vermilion border (HP:0012471): onset ; Delayed skeletal maturation (HP:0002750): onset ; Hearing impairment (HP:0000365): onset ; Absent speech (HP:0001344): onset ; Motor delay (HP:0001270): onset ; Global developmental delay (HP:0001263): onset ; Hypotonia (HP:0001252): onset ; excluded: Macroglossia (HP:0000158): onset ; excluded: Coarse facial features (HP:0000280): onset ; excluded: Sloping forehead (HP:0000340): onset ; excluded: 11 pairs of ribs (HP:0000878): onset ; excluded: Long philtrum (HP:0000343): onset ; excluded: Tented upper lip vermilion (HP:0010804): onset ; excluded: Upslanted palpebral fissure (HP:0000582): onset ; excluded: Epicanthus (HP:0000286): onset ; excluded: Long eyelashes (HP:0000527): onset ; excluded: Synophrys (HP:0000664): onset ; excluded: Wide nasal bridge (HP:0000431): onset ; excluded: Prominent metopic ridge (HP:0005487): onset ; excluded: Hirsutism (HP:0001007): onset ; excluded: Microcephaly (HP:0000252): onset ; excluded: Macrocephaly (HP:0000256): onset ; excluded: Short neck (HP:0000470): onset ; excluded: Corneal opacity (HP:0007957): onset ; excluded: Scoliosis (HP:0002650): onset ; excluded: Global brain atrophy (HP:0002283): onset ; excluded: Periventricular leukomalacia (HP:0006970): onset ; excluded: Developmental regression (HP:0002376): onset ; excluded: Hyporeflexia (HP:0001265): onset ; excluded: Seizure (HP:0001250): onset ; excluded: Deeply set eye (HP:0000490): onset ; excluded: Decreased fetal movement (HP:0001558): onset ; excluded: Oligohydramnios (HP:0001562): onset
Individual 6-2 (FEMALE; P3Y)Hypotonia, infantile, with psychomotor retardation and characteristic facies 3 (OMIM:616900)NM_001163435.3:c.1370del (homozygous)Broad forehead (HP:0000337): onset ; Macrocephaly (HP:0000256): onset ; Short neck (HP:0000470): onset ; Delayed skeletal maturation (HP:0002750): onset ; Delayed speech and language development (HP:0000750): onset ; Motor delay (HP:0001270): onset ; Global developmental delay (HP:0001263): onset ; Hypotonia (HP:0001252): onset ; excluded: Macroglossia (HP:0000158): onset ; excluded: Coarse facial features (HP:0000280): onset ; excluded: Sloping forehead (HP:0000340): onset ; excluded: 11 pairs of ribs (HP:0000878): onset ; excluded: Long philtrum (HP:0000343): onset ; excluded: Tented upper lip vermilion (HP:0010804): onset ; excluded: Upslanted palpebral fissure (HP:0000582): onset ; excluded: Epicanthus (HP:0000286): onset ; excluded: Mandibular prognathia (HP:0000303): onset ; excluded: Long eyelashes (HP:0000527): onset ; excluded: Synophrys (HP:0000664): onset ; excluded: Wide nasal bridge (HP:0000431): onset ; excluded: Bulbous nose (HP:0000414): onset ; excluded: Open mouth (HP:0000194): onset ; excluded: Thick vermilion border (HP:0012471): onset ; excluded: Prominent metopic ridge (HP:0005487): onset ; excluded: Hirsutism (HP:0001007): onset ; excluded: Microcephaly (HP:0000252): onset ; excluded: Corneal opacity (HP:0007957): onset ; excluded: Scoliosis (HP:0002650): onset ; excluded: Hearing impairment (HP:0000365): onset ; excluded: Global brain atrophy (HP:0002283): onset ; excluded: Periventricular leukomalacia (HP:0006970): onset ; excluded: Absent speech (HP:0001344): onset ; excluded: Developmental regression (HP:0002376): onset ; excluded: Hyporeflexia (HP:0001265): onset ; excluded: Seizure (HP:0001250): onset ; excluded: Deeply set eye (HP:0000490): onset ; excluded: Decreased fetal movement (HP:0001558): onset ; excluded: Oligohydramnios (HP:0001562): onset
Individual 7-1 (MALE; P6Y)Hypotonia, infantile, with psychomotor retardation and characteristic facies 3 (OMIM:616900)NM_001163435.3:c.455+4A>G (homozygous)Delayed speech and language development (HP:0000750): onset ; Motor delay (HP:0001270): onset ; Global developmental delay (HP:0001263): onset ; Hyporeflexia (HP:0001265): onset ; Hypotonia (HP:0001252): onset ; excluded: Macroglossia (HP:0000158): onset ; excluded: Coarse facial features (HP:0000280): onset ; excluded: Sloping forehead (HP:0000340): onset ; excluded: 11 pairs of ribs (HP:0000878): onset ; excluded: Long philtrum (HP:0000343): onset ; excluded: Tented upper lip vermilion (HP:0010804): onset ; excluded: Upslanted palpebral fissure (HP:0000582): onset ; excluded: Epicanthus (HP:0000286): onset ; excluded: Mandibular prognathia (HP:0000303): onset ; excluded: Long eyelashes (HP:0000527): onset ; excluded: Synophrys (HP:0000664): onset ; excluded: Broad forehead (HP:0000337): onset ; excluded: Wide nasal bridge (HP:0000431): onset ; excluded: Bulbous nose (HP:0000414): onset ; excluded: Open mouth (HP:0000194): onset ; excluded: Thick vermilion border (HP:0012471): onset ; excluded: Prominent metopic ridge (HP:0005487): onset ; excluded: Hirsutism (HP:0001007): onset ; excluded: Microcephaly (HP:0000252): onset ; excluded: Macrocephaly (HP:0000256): onset ; excluded: Short neck (HP:0000470): onset ; excluded: Corneal opacity (HP:0007957): onset ; excluded: Scoliosis (HP:0002650): onset ; excluded: Hearing impairment (HP:0000365): onset ; excluded: Global brain atrophy (HP:0002283): onset ; excluded: Periventricular leukomalacia (HP:0006970): onset ; excluded: Absent speech (HP:0001344): onset ; excluded: Developmental regression (HP:0002376): onset ; excluded: Seizure (HP:0001250): onset ; excluded: Deeply set eye (HP:0000490): onset ; excluded: Decreased fetal movement (HP:0001558): onset ; excluded: Oligohydramnios (HP:0001562): onset
Individual 8-1 (FEMALE; P12Y)Hypotonia, infantile, with psychomotor retardation and characteristic facies 3 (OMIM:616900)NM_001163435.3:c.376C>T (homozygous)Macroglossia (HP:0000158): onset ; Coarse facial features (HP:0000280): onset ; Macrocephaly (HP:0000256): onset ; Scoliosis (HP:0002650): onset ; Absent speech (HP:0001344): onset ; Motor delay (HP:0001270): onset ; Global developmental delay (HP:0001263): onset ; Hyporeflexia (HP:0001265): onset ; Seizure (HP:0001250): onset ; Hypotonia (HP:0001252): onset ; excluded: Sloping forehead (HP:0000340): onset ; excluded: 11 pairs of ribs (HP:0000878): onset ; excluded: Long philtrum (HP:0000343): onset ; excluded: Tented upper lip vermilion (HP:0010804): onset ; excluded: Upslanted palpebral fissure (HP:0000582): onset ; excluded: Epicanthus (HP:0000286): onset ; excluded: Mandibular prognathia (HP:0000303): onset ; excluded: Long eyelashes (HP:0000527): onset ; excluded: Synophrys (HP:0000664): onset ; excluded: Broad forehead (HP:0000337): onset ; excluded: Wide nasal bridge (HP:0000431): onset ; excluded: Bulbous nose (HP:0000414): onset ; excluded: Open mouth (HP:0000194): onset ; excluded: Thick vermilion border (HP:0012471): onset ; excluded: Prominent metopic ridge (HP:0005487): onset ; excluded: Hirsutism (HP:0001007): onset ; excluded: Microcephaly (HP:0000252): onset ; excluded: Short neck (HP:0000470): onset ; excluded: Corneal opacity (HP:0007957): onset ; excluded: Hearing impairment (HP:0000365): onset ; excluded: Global brain atrophy (HP:0002283): onset ; excluded: Periventricular leukomalacia (HP:0006970): onset ; excluded: Developmental regression (HP:0002376): onset ; excluded: Deeply set eye (HP:0000490): onset ; excluded: Decreased fetal movement (HP:0001558): onset ; excluded: Oligohydramnios (HP:0001562): onset
Individual 9-1 (FEMALE; P10Y)Hypotonia, infantile, with psychomotor retardation and characteristic facies 3 (OMIM:616900)
  • DELc.(658observed1_ 659-1)_ (2059observed1_2060-1del: chromosomal_deletion (SO:1000029)
  • NM_001163435.3:c.376C>T (heterozygous)
Prominent metopic ridge (HP:0005487): onset ; Absent speech (HP:0001344): onset ; Motor delay (HP:0001270): onset ; Global developmental delay (HP:0001263): onset ; Hypotonia (HP:0001252): onset ; excluded: Macroglossia (HP:0000158): onset ; excluded: Coarse facial features (HP:0000280): onset ; excluded: Sloping forehead (HP:0000340): onset ; excluded: 11 pairs of ribs (HP:0000878): onset ; excluded: Long philtrum (HP:0000343): onset ; excluded: Tented upper lip vermilion (HP:0010804): onset ; excluded: Upslanted palpebral fissure (HP:0000582): onset ; excluded: Epicanthus (HP:0000286): onset ; excluded: Mandibular prognathia (HP:0000303): onset ; excluded: Long eyelashes (HP:0000527): onset ; excluded: Synophrys (HP:0000664): onset ; excluded: Broad forehead (HP:0000337): onset ; excluded: Wide nasal bridge (HP:0000431): onset ; excluded: Bulbous nose (HP:0000414): onset ; excluded: Open mouth (HP:0000194): onset ; excluded: Thick vermilion border (HP:0012471): onset ; excluded: Hirsutism (HP:0001007): onset ; excluded: Microcephaly (HP:0000252): onset ; excluded: Macrocephaly (HP:0000256): onset ; excluded: Short neck (HP:0000470): onset ; excluded: Corneal opacity (HP:0007957): onset ; excluded: Scoliosis (HP:0002650): onset ; excluded: Hearing impairment (HP:0000365): onset ; excluded: Global brain atrophy (HP:0002283): onset ; excluded: Periventricular leukomalacia (HP:0006970): onset ; excluded: Developmental regression (HP:0002376): onset ; excluded: Seizure (HP:0001250): onset ; excluded: Deeply set eye (HP:0000490): onset
Individual 9-2 (MALE; P2Y)Hypotonia, infantile, with psychomotor retardation and characteristic facies 3 (OMIM:616900)
  • DELc.(658observed1_ 659-1)_ (2059observed1_2060-1del: chromosomal_deletion (SO:1000029)
  • NM_001163435.3:c.376C>T (heterozygous)
Coarse facial features (HP:0000280): onset ; 11 pairs of ribs (HP:0000878): onset ; Long philtrum (HP:0000343): onset ; Tented upper lip vermilion (HP:0010804): onset ; Epicanthus (HP:0000286): onset ; Hirsutism (HP:0001007): onset ; Absent speech (HP:0001344): onset ; Motor delay (HP:0001270): onset ; Global developmental delay (HP:0001263): onset ; Hypotonia (HP:0001252): onset ; excluded: Macroglossia (HP:0000158): onset ; excluded: Sloping forehead (HP:0000340): onset ; excluded: Upslanted palpebral fissure (HP:0000582): onset ; excluded: Mandibular prognathia (HP:0000303): onset ; excluded: Long eyelashes (HP:0000527): onset ; excluded: Synophrys (HP:0000664): onset ; excluded: Broad forehead (HP:0000337): onset ; excluded: Wide nasal bridge (HP:0000431): onset ; excluded: Bulbous nose (HP:0000414): onset ; excluded: Open mouth (HP:0000194): onset ; excluded: Thick vermilion border (HP:0012471): onset ; excluded: Prominent metopic ridge (HP:0005487): onset ; excluded: Microcephaly (HP:0000252): onset ; excluded: Macrocephaly (HP:0000256): onset ; excluded: Short neck (HP:0000470): onset ; excluded: Corneal opacity (HP:0007957): onset ; excluded: Scoliosis (HP:0002650): onset ; excluded: Hearing impairment (HP:0000365): onset ; excluded: Global brain atrophy (HP:0002283): onset ; excluded: Periventricular leukomalacia (HP:0006970): onset ; excluded: Developmental regression (HP:0002376): onset ; excluded: Seizure (HP:0001250): onset ; excluded: Deeply set eye (HP:0000490): onset ; excluded: Decreased fetal movement (HP:0001558): onset ; excluded: Oligohydramnios (HP:0001562): onset
A-II-1 (MALE; P14Y)Hypotonia, infantile, with psychomotor retardation and characteristic facies 3 (OMIM:616900)NM_001163435.3:c.376C>T (homozygous)Macroglossia (HP:0000158): onset ; Gingival overgrowth (HP:0000212): onset ; Coarse facial features (HP:0000280): onset ; Highly arched eyebrow (HP:0002553): onset ; Prominent nasal bridge (HP:0000426): onset ; Exaggerated cupid's bow (HP:0002263): onset ; Anteverted nares (HP:0000463): onset ; Narrow forehead (HP:0000341): onset ; Global developmental delay (HP:0001263): onset ; Developmental regression (HP:0002376): onset ; Hyporeflexia (HP:0001265): onset ; Hypotonia (HP:0001252): onset ; Cerebral visual impairment (HP:0100704): onset ; Ptosis (HP:0000508): onset ; Cataract (HP:0000518): onset ; Respiratory insufficiency (HP:0002093): onset ; Tube feeding (HP:0033454): onset ; Osteoporosis (HP:0000939): onset ; excluded: 11 pairs of ribs (HP:0000878): onset ; excluded: Hearing impairment (HP:0000365): onset ; excluded: Deeply set eye (HP:0000490): onset ; excluded: Esotropia (HP:0000565): onset ; excluded: Right aortic arch (HP:0012020): onset
TimeElement(element=Age(iso8601duration=P2Y6M)): Seizure (HP:0001250): onset age {\n", + " iso8601duration: \"P2Y6M\"\n", + "}\n", + "
B-IV-4 (FEMALE; P4Y)Hypotonia, infantile, with psychomotor retardation and characteristic facies 3 (OMIM:616900)NM_001163435.3:c.1363A>T (homozygous)Gingival overgrowth (HP:0000212): onset ; Highly arched eyebrow (HP:0002553): onset ; Prominent nasal bridge (HP:0000426): onset ; Exaggerated cupid's bow (HP:0002263): onset ; Anteverted nares (HP:0000463): onset ; Narrow forehead (HP:0000341): onset ; Global developmental delay (HP:0001263): onset ; Developmental regression (HP:0002376): onset ; Hyporeflexia (HP:0001265): onset ; Deeply set eye (HP:0000490): onset ; Hypotonia (HP:0001252): onset ; Cerebral visual impairment (HP:0100704): onset ; Respiratory insufficiency (HP:0002093): onset ; Tube feeding (HP:0033454): onset ; Osteoporosis (HP:0000939): onset ; excluded: Macroglossia (HP:0000158): onset ; excluded: Coarse facial features (HP:0000280): onset ; excluded: 11 pairs of ribs (HP:0000878): onset ; excluded: Hearing impairment (HP:0000365): onset ; excluded: Ptosis (HP:0000508): onset ; excluded: Cataract (HP:0000518): onset ; excluded: Esotropia (HP:0000565): onset ; excluded: Right aortic arch (HP:0012020): onset
TimeElement(element=Age(iso8601duration=P2Y1M)): Seizure (HP:0001250): onset age {\n", + " iso8601duration: \"P2Y1M\"\n", + "}\n", + "
B-IV-6 (FEMALE; P10Y)Hypotonia, infantile, with psychomotor retardation and characteristic facies 3 (OMIM:616900)NM_001163435.3:c.1363A>T (homozygous)Highly arched eyebrow (HP:0002553): onset ; Prominent nasal bridge (HP:0000426): onset ; Exaggerated cupid's bow (HP:0002263): onset ; Anteverted nares (HP:0000463): onset ; Narrow forehead (HP:0000341): onset ; Global developmental delay (HP:0001263): onset ; Developmental regression (HP:0002376): onset ; Deeply set eye (HP:0000490): onset ; Hypotonia (HP:0001252): onset ; Respiratory insufficiency (HP:0002093): onset ; Tube feeding (HP:0033454): onset ; Osteoporosis (HP:0000939): onset ; excluded: Macroglossia (HP:0000158): onset ; excluded: Coarse facial features (HP:0000280): onset ; excluded: 11 pairs of ribs (HP:0000878): onset ; excluded: Hearing impairment (HP:0000365): onset ; excluded: Cerebral visual impairment (HP:0100704): onset ; excluded: Ptosis (HP:0000508): onset ; excluded: Cataract (HP:0000518): onset ; excluded: Esotropia (HP:0000565): onset ; excluded: Right aortic arch (HP:0012020): onset
TimeElement(element=Age(iso8601duration=P6Y)): Seizure (HP:0001250): onset age {\n", + " iso8601duration: \"P6Y\"\n", + "}\n", + "
C-II-1 (MALE; P2Y)Hypotonia, infantile, with psychomotor retardation and characteristic facies 3 (OMIM:616900)NM_001163435.3:c.1532G>A (homozygous)Coarse facial features (HP:0000280): onset ; 11 pairs of ribs (HP:0000878): onset ; Prominent nasal bridge (HP:0000426): onset ; Exaggerated cupid's bow (HP:0002263): onset ; Anteverted nares (HP:0000463): onset ; Narrow forehead (HP:0000341): onset ; Global developmental delay (HP:0001263): onset ; Hyporeflexia (HP:0001265): onset ; Hypotonia (HP:0001252): onset ; Esotropia (HP:0000565): onset ; Tube feeding (HP:0033454): onset ; Right aortic arch (HP:0012020): onset ; excluded: Macroglossia (HP:0000158): onset ; excluded: Highly arched eyebrow (HP:0002553): onset ; excluded: Hearing impairment (HP:0000365): onset ; excluded: Developmental regression (HP:0002376): onset ; excluded: Seizure (HP:0001250): onset ; excluded: Deeply set eye (HP:0000490): onset ; excluded: Cerebral visual impairment (HP:0100704): onset ; excluded: Ptosis (HP:0000508): onset ; excluded: Cataract (HP:0000518): onset ; excluded: Respiratory insufficiency (HP:0002093): onset ; excluded: Osteoporosis (HP:0000939): onset
D-II-1 (MALE; P14Y)Hypotonia, infantile, with psychomotor retardation and characteristic facies 3 (OMIM:616900)NM_001163435.3:c.376C>T (homozygous)Macroglossia (HP:0000158): onset ; Coarse facial features (HP:0000280): onset ; Highly arched eyebrow (HP:0002553): onset ; Prominent nasal bridge (HP:0000426): onset ; Exaggerated cupid's bow (HP:0002263): onset ; Narrow forehead (HP:0000341): onset ; Global developmental delay (HP:0001263): onset ; Developmental regression (HP:0002376): onset ; Hyporeflexia (HP:0001265): onset ; Deeply set eye (HP:0000490): onset ; Hypotonia (HP:0001252): onset ; Cerebral visual impairment (HP:0100704): onset ; Respiratory insufficiency (HP:0002093): onset ; Tube feeding (HP:0033454): onset ; Osteoporosis (HP:0000939): onset ; excluded: Gingival overgrowth (HP:0000212): onset ; excluded: 11 pairs of ribs (HP:0000878): onset ; excluded: Anteverted nares (HP:0000463): onset ; excluded: Hearing impairment (HP:0000365): onset ; excluded: Ptosis (HP:0000508): onset ; excluded: Cataract (HP:0000518): onset ; excluded: Esotropia (HP:0000565): onset ; excluded: Right aortic arch (HP:0012020): onset
TimeElement(element=Age(iso8601duration=P1Y3M)): Seizure (HP:0001250): onset age {\n", + " iso8601duration: \"P1Y3M\"\n", + "}\n", + "
Patient 1 (MALE; P9Y)Hypotonia, infantile, with psychomotor retardation and characteristic facies 3 (OMIM:616900)NM_001163435.3:c.614_617del (homozygous)Brachycephaly (HP:0000248): onset ; Motor delay (HP:0001270): onset ; Global developmental delay (HP:0001263): onset ; Hypotonia (HP:0001252): onset ; Cerebral visual impairment (HP:0100704): onset ; Strabismus (HP:0000486): onset ; Proptosis (HP:0000520): onset ; Single transverse palmar crease (HP:0000954): onset ; Overlapping toe (HP:0001845): onset ; excluded: Cerebellar atrophy (HP:0001272): onset
TimeElement(element=Age(iso8601duration=P9M)): Seizure (HP:0001250): onset age {\n", + " iso8601duration: \"P9M\"\n", + "}\n", + "
Patient 2 (MALE; P16Y)Hypotonia, infantile, with psychomotor retardation and characteristic facies 3 (OMIM:616900)NM_001163435.3:c.614_617del (homozygous)Brachycephaly (HP:0000248): onset ; Motor delay (HP:0001270): onset ; Global developmental delay (HP:0001263): onset ; Hypotonia (HP:0001252): onset ; Strabismus (HP:0000486): onset ; Proptosis (HP:0000520): onset ; Single transverse palmar crease (HP:0000954): onset ; Overlapping toe (HP:0001845): onset ; excluded: Cerebellar atrophy (HP:0001272): onset
TimeElement(element=Age(iso8601duration=P2Y11M)): Seizure (HP:0001250): onset age {\n", + " iso8601duration: \"P2Y11M\"\n", + "}\n", + "
Patient 3 (FEMALE; P11Y)Hypotonia, infantile, with psychomotor retardation and characteristic facies 3 (OMIM:616900)NM_001163435.3:c.614_617del (homozygous)Brachycephaly (HP:0000248): onset ; Cerebellar atrophy (HP:0001272): onset ; Global developmental delay (HP:0001263): onset ; Hypotonia (HP:0001252): onset ; Strabismus (HP:0000486): onset ; Proptosis (HP:0000520): onset ; Single transverse palmar crease (HP:0000954): onset ; Overlapping toe (HP:0001845): onset
TimeElement(element=Age(iso8601duration=P1Y6M)): Seizure (HP:0001250): onset age {\n", + " iso8601duration: \"P1Y6M\"\n", + "}\n", + "
Patient 1 (FEMALE; P5Y)Hypotonia, infantile, with psychomotor retardation and characteristic facies 3 (OMIM:616900)NM_001163435.3:c.753dup (homozygous)Long philtrum (HP:0000343): onset ; Open mouth (HP:0000194): onset ; Brachycephaly (HP:0000248): onset ; Absent speech (HP:0001344): onset ; Motor delay (HP:0001270): onset ; Global developmental delay (HP:0001263): onset ; EMG: myokymic discharges (HP:0100288): onset ; Deeply set eye (HP:0000490): onset ; Hypotonia (HP:0001252): onset ; excluded: Narrow forehead (HP:0000341): onset ; excluded: Macrocephaly (HP:0000256): onset ; excluded: Scoliosis (HP:0002650): onset ; excluded: Strabismus (HP:0000486): onset ; excluded: Respiratory insufficiency (HP:0002093): onset
TimeElement(element=Age(iso8601duration=P2Y)): Seizure (HP:0001250): onset age {\n", + " iso8601duration: \"P2Y\"\n", + "}\n", + "
Patient 2 (FEMALE; P3Y)Hypotonia, infantile, with psychomotor retardation and characteristic facies 3 (OMIM:616900)NM_001163435.3:c.753dup (homozygous)Long philtrum (HP:0000343): onset ; Open mouth (HP:0000194): onset ; Brachycephaly (HP:0000248): onset ; Absent speech (HP:0001344): onset ; Motor delay (HP:0001270): onset ; Global developmental delay (HP:0001263): onset ; Deeply set eye (HP:0000490): onset ; Hypotonia (HP:0001252): onset ; Strabismus (HP:0000486): onset ; excluded: Narrow forehead (HP:0000341): onset ; excluded: Macrocephaly (HP:0000256): onset ; excluded: Scoliosis (HP:0002650): onset ; excluded: EMG: myokymic discharges (HP:0100288): onset ; excluded: Status epilepticus (HP:0002133): onset ; excluded: Respiratory insufficiency (HP:0002093): onset
patient (MALE; P1Y3M)Hypotonia, infantile, with psychomotor retardation and characteristic facies 3 (OMIM:616900)NM_001163435.3:c.247C>T (homozygous)Macroglossia (HP:0000158): onset ; Coarse facial features (HP:0000280): onset ; Tented upper lip vermilion (HP:0010804): onset ; Highly arched eyebrow (HP:0002553): onset ; Hypertelorism (HP:0000316): onset ; Exaggerated cupid's bow (HP:0002263): onset ; Open mouth (HP:0000194): onset ; Delayed speech and language development (HP:0000750): onset ; Motor delay (HP:0001270): onset ; Hyporeflexia (HP:0001265): onset ; Cryptorchidism (HP:0000028): onset ; Pectus excavatum (HP:0000767): onset ; excluded: Gingival overgrowth (HP:0000212): onset ; excluded: Sloping forehead (HP:0000340): onset ; excluded: Long philtrum (HP:0000343): onset ; excluded: Upslanted palpebral fissure (HP:0000582): onset ; excluded: Epicanthus (HP:0000286): onset ; excluded: Mandibular prognathia (HP:0000303): onset ; excluded: Long eyelashes (HP:0000527): onset ; excluded: Synophrys (HP:0000664): onset ; excluded: Broad forehead (HP:0000337): onset ; excluded: Prominent nasal bridge (HP:0000426): onset ; excluded: Wide nasal bridge (HP:0000431): onset ; excluded: Anteverted nares (HP:0000463): onset ; excluded: Bulbous nose (HP:0000414): onset ; excluded: Thick vermilion border (HP:0012471): onset ; excluded: Prominent metopic ridge (HP:0005487): onset ; excluded: Hirsutism (HP:0001007): onset ; excluded: Cerebellar atrophy (HP:0001272): onset ; excluded: Periventricular leukomalacia (HP:0006970): onset ; excluded: Seizure (HP:0001250): onset ; excluded: Deeply set eye (HP:0000490): onset
TimeElement(element=OntologyClass(id=HP:0003577, label=Congenital onset)): Macrocephaly (HP:0000256): onset ontology_class {\n", + " id: \"HP:0003577\"\n", + " label: \"Congenital onset\"\n", + "}\n", + "
TimeElement(element=OntologyClass(id=HP:0003623, label=Neonatal onset)): Hypotonia (HP:0001252): onset ontology_class {\n", + " id: \"HP:0003623\"\n", + " label: \"Neonatal onset\"\n", + "}\n", + "
TimeElement(element=Age(iso8601duration=P5M)): Global brain atrophy (HP:0002283): onset age {\n", + " iso8601duration: \"P5M\"\n", + "}\n", + "
Individual P1 (FEMALE; P13Y)Hypotonia, infantile, with psychomotor retardation and characteristic facies 3 (OMIM:616900)NM_001163435.3:c.535_554del (homozygous)Hirsutism (HP:0001007): onset ; Tapered finger (HP:0001182): onset ; Scoliosis (HP:0002650): onset ; Joint contracture (HP:0034392): onset ; Thin corpus callosum (HP:0033725): onset ; Ventriculomegaly (HP:0002119): onset ; Enlarged cisterna magna (HP:0002280): onset ; Absent speech (HP:0001344): onset ; Motor delay (HP:0001270): onset ; Global developmental delay (HP:0001263): onset ; Hyporeflexia (HP:0001265): onset ; Increased variability in muscle fiber diameter (HP:0003557): onset ; Mildly elevated creatine kinase (HP:0008180): onset ; Limb muscle weakness (HP:0003690): onset ; Axial muscle weakness (HP:0003327): onset ; excluded: Cerebellar atrophy (HP:0001272): onset ; excluded: Global brain atrophy (HP:0002283): onset ; excluded: Developmental regression (HP:0002376): onset ; excluded: Status epilepticus (HP:0002133): onset
TimeElement(element=OntologyClass(id=HP:0003623, label=Neonatal onset)): Hypotonia (HP:0001252): onset ontology_class {\n", + " id: \"HP:0003623\"\n", + " label: \"Neonatal onset\"\n", + "}\n", + "
TimeElement(element=Age(iso8601duration=P1Y4M)): Macrocephaly (HP:0000256): onset age {\n", + " iso8601duration: \"P1Y4M\"\n", + "}\n", + "; Bilateral tonic-clonic seizure with focal onset (HP:0007334): onset age {\n", + " iso8601duration: \"P1Y4M\"\n", + "}\n", + "
Individual P2 (FEMALE; P8Y)Hypotonia, infantile, with psychomotor retardation and characteristic facies 3 (OMIM:616900)NM_001163435.3:c.535_554del (homozygous)Thin corpus callosum (HP:0033725): onset ; Ventriculomegaly (HP:0002119): onset ; Absent speech (HP:0001344): onset ; Motor delay (HP:0001270): onset ; Global developmental delay (HP:0001263): onset ; Hyporeflexia (HP:0001265): onset ; Increased variability in muscle fiber diameter (HP:0003557): onset ; Limb muscle weakness (HP:0003690): onset ; Axial muscle weakness (HP:0003327): onset ; Hypotonia (HP:0001252): onset ; excluded: Hirsutism (HP:0001007): onset ; excluded: Tapered finger (HP:0001182): onset ; excluded: Scoliosis (HP:0002650): onset ; excluded: Joint contracture (HP:0034392): onset ; excluded: Cerebellar atrophy (HP:0001272): onset ; excluded: Global brain atrophy (HP:0002283): onset ; excluded: Developmental regression (HP:0002376): onset ; excluded: Status epilepticus (HP:0002133): onset
TimeElement(element=OntologyClass(id=HP:0003623, label=Neonatal onset)): Mildly elevated creatine kinase (HP:0008180): onset ontology_class {\n", + " id: \"HP:0003623\"\n", + " label: \"Neonatal onset\"\n", + "}\n", + "
TimeElement(element=Age(iso8601duration=P9M)): Bilateral tonic-clonic seizure with focal onset (HP:0007334): onset age {\n", + " iso8601duration: \"P9M\"\n", + "}\n", + "
patient (FEMALE; P6Y6M)Hypotonia, infantile, with psychomotor retardation and characteristic facies 3 (OMIM:616900)NM_001163435.3:c.490C>T (homozygous)Thick vermilion border (HP:0012471): onset ; Narrow forehead (HP:0000341): onset ; Periventricular leukomalacia (HP:0006970): onset ; Absent speech (HP:0001344): onset ; Motor delay (HP:0001270): onset ; Global developmental delay (HP:0001263): onset ; Hyporeflexia (HP:0001265): onset ; Hypotonia (HP:0001252): onset ; Feeding difficulties (HP:0011968): onset ; excluded: Macroglossia (HP:0000158): onset ; excluded: Gingival overgrowth (HP:0000212): onset ; excluded: Coarse facial features (HP:0000280): onset ; excluded: Sloping forehead (HP:0000340): onset ; excluded: Tented upper lip vermilion (HP:0010804): onset ; excluded: Upslanted palpebral fissure (HP:0000582): onset ; excluded: Epicanthus (HP:0000286): onset ; excluded: Hypertelorism (HP:0000316): onset ; excluded: Synophrys (HP:0000664): onset ; excluded: Prominent nasal bridge (HP:0000426): onset ; excluded: Wide nasal bridge (HP:0000431): onset ; excluded: Exaggerated cupid's bow (HP:0002263): onset ; excluded: Anteverted nares (HP:0000463): onset ; excluded: Bulbous nose (HP:0000414): onset ; excluded: Prominent metopic ridge (HP:0005487): onset ; excluded: Brachycephaly (HP:0000248): onset
" ], "text/plain": [ @@ -147,6 +197,199 @@ "table = IndividualTable(cvalidator.get_error_free_individual_list())\n", "display(HTML(table.to_html()))" ] + }, + { + "cell_type": "code", + "execution_count": 14, + "metadata": {}, + "outputs": [ + { + "name": "stdout", + "output_type": "stream", + "text": [ + "[pyphetools] Ingested 27 GA4GH phenopackets.\n", + "[INFO] Extracted 27 from 27 phenopackets with OMIM:616900\n", + "\n", + "\tHypotonia, infantile, with psychomotor retardation and characteristic facies 3 (OMIM:616900): n=27\n", + "We found a total of 74 unique HPO terms\n", + "Extracted disease: Hypotonia, infantile, with psychomotor retardation and characteristic facies 3 (OMIM:616900)\n", + "Wrote HPOA disease file to OMIM-616900.tab\n" + ] + }, + { + "data": { + "text/html": [ + "
\n", + "\n", + "\n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + " \n", + "
#diseaseIDdiseaseNamephenotypeIDphenotypeNameonsetIDonsetNamefrequencysexnegationmodifierdescriptionpublicationevidencebiocuration
0OMIM:616900Hypotonia, infantile, with psychomotor retarda...HP:0000256Macrocephaly4/13PMID:27040691PCSORCID:0000-0002-0736-9199[2024-10-04]
1OMIM:616900Hypotonia, infantile, with psychomotor retarda...HP:0001344Absent speech7/13PMID:27040691PCSORCID:0000-0002-0736-9199[2024-10-04]
2OMIM:616900Hypotonia, infantile, with psychomotor retarda...HP:0001270Motor delay12/13PMID:27040691PCSORCID:0000-0002-0736-9199[2024-10-04]
3OMIM:616900Hypotonia, infantile, with psychomotor retarda...HP:0001263Global developmental delay13/13PMID:27040691PCSORCID:0000-0002-0736-9199[2024-10-04]
4OMIM:616900Hypotonia, infantile, with psychomotor retarda...HP:0001265Hyporeflexia8/11PMID:27040691PCSORCID:0000-0002-0736-9199[2024-10-04]
\n", + "
" + ], + "text/plain": [ + " #diseaseID diseaseName phenotypeID \\\n", + "0 OMIM:616900 Hypotonia, infantile, with psychomotor retarda... HP:0000256 \n", + "1 OMIM:616900 Hypotonia, infantile, with psychomotor retarda... HP:0001344 \n", + "2 OMIM:616900 Hypotonia, infantile, with psychomotor retarda... HP:0001270 \n", + "3 OMIM:616900 Hypotonia, infantile, with psychomotor retarda... HP:0001263 \n", + "4 OMIM:616900 Hypotonia, infantile, with psychomotor retarda... HP:0001265 \n", + "\n", + " phenotypeName onsetID onsetName frequency sex negation \\\n", + "0 Macrocephaly 4/13 \n", + "1 Absent speech 7/13 \n", + "2 Motor delay 12/13 \n", + "3 Global developmental delay 13/13 \n", + "4 Hyporeflexia 8/11 \n", + "\n", + " modifier description publication evidence \\\n", + "0 PMID:27040691 PCS \n", + "1 PMID:27040691 PCS \n", + "2 PMID:27040691 PCS \n", + "3 PMID:27040691 PCS \n", + "4 PMID:27040691 PCS \n", + "\n", + " biocuration \n", + "0 ORCID:0000-0002-0736-9199[2024-10-04] \n", + "1 ORCID:0000-0002-0736-9199[2024-10-04] \n", + "2 ORCID:0000-0002-0736-9199[2024-10-04] \n", + "3 ORCID:0000-0002-0736-9199[2024-10-04] \n", + "4 ORCID:0000-0002-0736-9199[2024-10-04] " + ] + }, + "execution_count": 14, + "metadata": {}, + "output_type": "execute_result" + } + ], + "source": [ + "pmid = \"PMID:26805781\"\n", + "df = timporter.create_hpoa_from_phenopackets(pmid=pmid, mode_of_inheritance=Moi.AR, target=\"OMIM:616900\")\n", + "df.head()" + ] + }, + { + "cell_type": "code", + "execution_count": null, + "metadata": {}, + "outputs": [], + "source": [] } ], "metadata": { @@ -165,7 +408,7 @@ "name": "python", "nbconvert_exporter": "python", "pygments_lexer": "ipython3", - "version": "3.9.6" + "version": "3.12.4" } }, "nbformat": 4, diff --git a/notebooks/TBCK/input/TBCK_IHPRF3_individuals.xlsx b/notebooks/TBCK/input/TBCK_IHPRF3_individuals.xlsx index 3d7ffe8e8..30232a511 100644 Binary files a/notebooks/TBCK/input/TBCK_IHPRF3_individuals.xlsx and b/notebooks/TBCK/input/TBCK_IHPRF3_individuals.xlsx differ diff --git a/notebooks/TBCK/phenopackets/PMID_27040691_Individual1-1a.json b/notebooks/TBCK/phenopackets/PMID_27040691_Individual1-1a.json index c6e035741..5ac64e9c5 100644 --- a/notebooks/TBCK/phenopackets/PMID_27040691_Individual1-1a.json +++ b/notebooks/TBCK/phenopackets/PMID_27040691_Individual1-1a.json @@ -1,5 +1,5 @@ { - "id": "PMID_27040691_Individual_1-1a", + "id": "PMID_27040691_Individual_1_1a", "subject": { "id": "Individual 1-1a", "timeAtLastEncounter": { @@ -7,6 +7,14 @@ "iso8601duration": "P5Y" } }, + "vitalStatus": { + "status": "DECEASED", + "timeOfDeath": { + "age": { + "iso8601duration": "P5Y" + } + } + }, "sex": "MALE" }, "phenotypicFeatures": [ @@ -315,7 +323,7 @@ } ], "metaData": { - "created": "2024-04-28T17:04:44.479068994Z", + "created": "2024-10-04T18:13:39.631210088Z", "createdBy": "ORCID:0000-0002-0736-9199", "resources": [ { @@ -354,7 +362,7 @@ "id": "hp", "name": "human phenotype ontology", "url": "http://purl.obolibrary.org/obo/hp.owl", - "version": "2024-04-26", + "version": "2024-08-13", "namespacePrefix": "HP", "iriPrefix": "http://purl.obolibrary.org/obo/HP_" } diff --git a/notebooks/TBCK/phenopackets/PMID_27040691_Individual1-2a.json b/notebooks/TBCK/phenopackets/PMID_27040691_Individual1-2a.json index e1433e493..846f4ac7f 100644 --- a/notebooks/TBCK/phenopackets/PMID_27040691_Individual1-2a.json +++ b/notebooks/TBCK/phenopackets/PMID_27040691_Individual1-2a.json @@ -1,5 +1,5 @@ { - "id": "PMID_27040691_Individual_1-2a", + "id": "PMID_27040691_Individual_1_2a", "subject": { "id": "Individual 1-2a", "timeAtLastEncounter": { @@ -7,6 +7,9 @@ "iso8601duration": "P11Y" } }, + "vitalStatus": { + "status": "ALIVE" + }, "sex": "FEMALE" }, "phenotypicFeatures": [ @@ -311,7 +314,7 @@ } ], "metaData": { - "created": "2024-04-28T17:04:44.480370998Z", + "created": "2024-10-04T18:13:39.632406949Z", "createdBy": "ORCID:0000-0002-0736-9199", "resources": [ { @@ -350,7 +353,7 @@ "id": "hp", "name": "human phenotype ontology", "url": "http://purl.obolibrary.org/obo/hp.owl", - "version": "2024-04-26", + "version": "2024-08-13", "namespacePrefix": "HP", "iriPrefix": "http://purl.obolibrary.org/obo/HP_" } diff --git a/notebooks/TBCK/phenopackets/PMID_27040691_Individual2-1.json b/notebooks/TBCK/phenopackets/PMID_27040691_Individual2-1.json index cd20e02c6..00057faf2 100644 --- a/notebooks/TBCK/phenopackets/PMID_27040691_Individual2-1.json +++ b/notebooks/TBCK/phenopackets/PMID_27040691_Individual2-1.json @@ -1,5 +1,5 @@ { - "id": "PMID_27040691_Individual_2-1", + "id": "PMID_27040691_Individual_2_1", "subject": { "id": "Individual 2-1", "timeAtLastEncounter": { @@ -7,6 +7,9 @@ "iso8601duration": "P5Y" } }, + "vitalStatus": { + "status": "ALIVE" + }, "sex": "MALE" }, "phenotypicFeatures": [ @@ -314,7 +317,7 @@ } ], "metaData": { - "created": "2024-04-28T17:04:44.481378078Z", + "created": "2024-10-04T18:13:39.633231163Z", "createdBy": "ORCID:0000-0002-0736-9199", "resources": [ { @@ -353,7 +356,7 @@ "id": "hp", "name": "human phenotype ontology", "url": "http://purl.obolibrary.org/obo/hp.owl", - "version": "2024-04-26", + "version": "2024-08-13", "namespacePrefix": "HP", "iriPrefix": "http://purl.obolibrary.org/obo/HP_" } diff --git a/notebooks/TBCK/phenopackets/PMID_27040691_Individual3-1.json b/notebooks/TBCK/phenopackets/PMID_27040691_Individual3-1.json index 9a933729b..b6785aec3 100644 --- a/notebooks/TBCK/phenopackets/PMID_27040691_Individual3-1.json +++ b/notebooks/TBCK/phenopackets/PMID_27040691_Individual3-1.json @@ -1,5 +1,5 @@ { - "id": "PMID_27040691_Individual_3-1", + "id": "PMID_27040691_Individual_3_1", "subject": { "id": "Individual 3-1", "timeAtLastEncounter": { @@ -7,6 +7,9 @@ "iso8601duration": "P11Y" } }, + "vitalStatus": { + "status": "ALIVE" + }, "sex": "MALE" }, "phenotypicFeatures": [ @@ -320,7 +323,7 @@ } ], "metaData": { - "created": "2024-04-28T17:04:44.482364892Z", + "created": "2024-10-04T18:13:39.633987188Z", "createdBy": "ORCID:0000-0002-0736-9199", "resources": [ { @@ -359,7 +362,7 @@ "id": "hp", "name": "human phenotype ontology", "url": "http://purl.obolibrary.org/obo/hp.owl", - "version": "2024-04-26", + "version": "2024-08-13", "namespacePrefix": "HP", "iriPrefix": "http://purl.obolibrary.org/obo/HP_" } diff --git a/notebooks/TBCK/phenopackets/PMID_27040691_Individual4-1.json b/notebooks/TBCK/phenopackets/PMID_27040691_Individual4-1.json index 13d25b9ec..8e07237b7 100644 --- a/notebooks/TBCK/phenopackets/PMID_27040691_Individual4-1.json +++ b/notebooks/TBCK/phenopackets/PMID_27040691_Individual4-1.json @@ -1,5 +1,5 @@ { - "id": "PMID_27040691_Individual_4-1", + "id": "PMID_27040691_Individual_4_1", "subject": { "id": "Individual 4-1", "timeAtLastEncounter": { @@ -7,6 +7,9 @@ "iso8601duration": "P4Y" } }, + "vitalStatus": { + "status": "ALIVE" + }, "sex": "FEMALE" }, "phenotypicFeatures": [ @@ -344,7 +347,7 @@ } ], "metaData": { - "created": "2024-04-28T17:04:44.483371019Z", + "created": "2024-10-04T18:13:39.635034799Z", "createdBy": "ORCID:0000-0002-0736-9199", "resources": [ { @@ -383,7 +386,7 @@ "id": "hp", "name": "human phenotype ontology", "url": "http://purl.obolibrary.org/obo/hp.owl", - "version": "2024-04-26", + "version": "2024-08-13", "namespacePrefix": "HP", "iriPrefix": "http://purl.obolibrary.org/obo/HP_" } diff --git a/notebooks/TBCK/phenopackets/PMID_27040691_Individual4-2.json b/notebooks/TBCK/phenopackets/PMID_27040691_Individual4-2.json index 7f818b019..dc9ca26aa 100644 --- a/notebooks/TBCK/phenopackets/PMID_27040691_Individual4-2.json +++ b/notebooks/TBCK/phenopackets/PMID_27040691_Individual4-2.json @@ -1,5 +1,5 @@ { - "id": "PMID_27040691_Individual_4-2", + "id": "PMID_27040691_Individual_4_2", "subject": { "id": "Individual 4-2", "timeAtLastEncounter": { @@ -7,6 +7,9 @@ "iso8601duration": "P2Y" } }, + "vitalStatus": { + "status": "ALIVE" + }, "sex": "FEMALE" }, "phenotypicFeatures": [ @@ -357,7 +360,7 @@ } ], "metaData": { - "created": "2024-04-28T17:04:44.484419107Z", + "created": "2024-10-04T18:13:39.636062860Z", "createdBy": "ORCID:0000-0002-0736-9199", "resources": [ { @@ -396,7 +399,7 @@ "id": "hp", "name": "human phenotype ontology", "url": "http://purl.obolibrary.org/obo/hp.owl", - "version": "2024-04-26", + "version": "2024-08-13", "namespacePrefix": "HP", "iriPrefix": "http://purl.obolibrary.org/obo/HP_" } diff --git a/notebooks/TBCK/phenopackets/PMID_27040691_Individual5-1.json b/notebooks/TBCK/phenopackets/PMID_27040691_Individual5-1.json index aa44f92eb..5d4ec83c1 100644 --- a/notebooks/TBCK/phenopackets/PMID_27040691_Individual5-1.json +++ b/notebooks/TBCK/phenopackets/PMID_27040691_Individual5-1.json @@ -1,5 +1,5 @@ { - "id": "PMID_27040691_Individual_5-1", + "id": "PMID_27040691_Individual_5_1", "subject": { "id": "Individual 5-1", "timeAtLastEncounter": { @@ -7,6 +7,9 @@ "iso8601duration": "P10Y" } }, + "vitalStatus": { + "status": "ALIVE" + }, "sex": "FEMALE" }, "phenotypicFeatures": [ @@ -307,7 +310,7 @@ } ], "metaData": { - "created": "2024-04-28T17:04:44.485736846Z", + "created": "2024-10-04T18:13:39.636994123Z", "createdBy": "ORCID:0000-0002-0736-9199", "resources": [ { @@ -346,7 +349,7 @@ "id": "hp", "name": "human phenotype ontology", "url": "http://purl.obolibrary.org/obo/hp.owl", - "version": "2024-04-26", + "version": "2024-08-13", "namespacePrefix": "HP", "iriPrefix": "http://purl.obolibrary.org/obo/HP_" } diff --git a/notebooks/TBCK/phenopackets/PMID_27040691_Individual6-1.json b/notebooks/TBCK/phenopackets/PMID_27040691_Individual6-1.json index a78352a79..5c934ba11 100644 --- a/notebooks/TBCK/phenopackets/PMID_27040691_Individual6-1.json +++ b/notebooks/TBCK/phenopackets/PMID_27040691_Individual6-1.json @@ -1,5 +1,5 @@ { - "id": "PMID_27040691_Individual_6-1", + "id": "PMID_27040691_Individual_6_1", "subject": { "id": "Individual 6-1", "timeAtLastEncounter": { @@ -7,6 +7,9 @@ "iso8601duration": "P12Y" } }, + "vitalStatus": { + "status": "ALIVE" + }, "sex": "MALE" }, "phenotypicFeatures": [ @@ -317,7 +320,7 @@ } ], "metaData": { - "created": "2024-04-28T17:04:44.486725807Z", + "created": "2024-10-04T18:13:39.637748003Z", "createdBy": "ORCID:0000-0002-0736-9199", "resources": [ { @@ -356,7 +359,7 @@ "id": "hp", "name": "human phenotype ontology", "url": "http://purl.obolibrary.org/obo/hp.owl", - "version": "2024-04-26", + "version": "2024-08-13", "namespacePrefix": "HP", "iriPrefix": "http://purl.obolibrary.org/obo/HP_" } diff --git a/notebooks/TBCK/phenopackets/PMID_27040691_Individual6-2.json b/notebooks/TBCK/phenopackets/PMID_27040691_Individual6-2.json index 51c2e241e..fe4b9b88a 100644 --- a/notebooks/TBCK/phenopackets/PMID_27040691_Individual6-2.json +++ b/notebooks/TBCK/phenopackets/PMID_27040691_Individual6-2.json @@ -1,5 +1,5 @@ { - "id": "PMID_27040691_Individual_6-2", + "id": "PMID_27040691_Individual_6_2", "subject": { "id": "Individual 6-2", "timeAtLastEncounter": { @@ -7,6 +7,9 @@ "iso8601duration": "P3Y" } }, + "vitalStatus": { + "status": "ALIVE" + }, "sex": "FEMALE" }, "phenotypicFeatures": [ @@ -327,7 +330,7 @@ } ], "metaData": { - "created": "2024-04-28T17:04:44.487763881Z", + "created": "2024-10-04T18:13:39.638494014Z", "createdBy": "ORCID:0000-0002-0736-9199", "resources": [ { @@ -366,7 +369,7 @@ "id": "hp", "name": "human phenotype ontology", "url": "http://purl.obolibrary.org/obo/hp.owl", - "version": "2024-04-26", + "version": "2024-08-13", "namespacePrefix": "HP", "iriPrefix": "http://purl.obolibrary.org/obo/HP_" } diff --git a/notebooks/TBCK/phenopackets/PMID_27040691_Individual7-1.json b/notebooks/TBCK/phenopackets/PMID_27040691_Individual7-1.json index aad090a63..51cec145f 100644 --- a/notebooks/TBCK/phenopackets/PMID_27040691_Individual7-1.json +++ b/notebooks/TBCK/phenopackets/PMID_27040691_Individual7-1.json @@ -1,5 +1,5 @@ { - "id": "PMID_27040691_Individual_7-1", + "id": "PMID_27040691_Individual_7_1", "subject": { "id": "Individual 7-1", "timeAtLastEncounter": { @@ -7,6 +7,9 @@ "iso8601duration": "P6Y" } }, + "vitalStatus": { + "status": "ALIVE" + }, "sex": "MALE" }, "phenotypicFeatures": [ @@ -323,7 +326,7 @@ } ], "metaData": { - "created": "2024-04-28T17:04:44.488849878Z", + "created": "2024-10-04T18:13:39.639515876Z", "createdBy": "ORCID:0000-0002-0736-9199", "resources": [ { @@ -362,7 +365,7 @@ "id": "hp", "name": "human phenotype ontology", "url": "http://purl.obolibrary.org/obo/hp.owl", - "version": "2024-04-26", + "version": "2024-08-13", "namespacePrefix": "HP", "iriPrefix": "http://purl.obolibrary.org/obo/HP_" } diff --git a/notebooks/TBCK/phenopackets/PMID_27040691_Individual8-1.json b/notebooks/TBCK/phenopackets/PMID_27040691_Individual8-1.json index da8ed4a62..b98898c9f 100644 --- a/notebooks/TBCK/phenopackets/PMID_27040691_Individual8-1.json +++ b/notebooks/TBCK/phenopackets/PMID_27040691_Individual8-1.json @@ -1,5 +1,5 @@ { - "id": "PMID_27040691_Individual_8-1", + "id": "PMID_27040691_Individual_8_1", "subject": { "id": "Individual 8-1", "timeAtLastEncounter": { @@ -7,6 +7,9 @@ "iso8601duration": "P12Y" } }, + "vitalStatus": { + "status": "ALIVE" + }, "sex": "FEMALE" }, "phenotypicFeatures": [ @@ -311,7 +314,7 @@ } ], "metaData": { - "created": "2024-04-28T17:04:44.489935874Z", + "created": "2024-10-04T18:13:39.640480995Z", "createdBy": "ORCID:0000-0002-0736-9199", "resources": [ { @@ -350,7 +353,7 @@ "id": "hp", "name": "human phenotype ontology", "url": "http://purl.obolibrary.org/obo/hp.owl", - "version": "2024-04-26", + "version": "2024-08-13", "namespacePrefix": "HP", "iriPrefix": "http://purl.obolibrary.org/obo/HP_" } diff --git a/notebooks/TBCK/phenopackets/PMID_27040691_Individual9-1.json b/notebooks/TBCK/phenopackets/PMID_27040691_Individual9-1.json index 4b295f198..6001c7f92 100644 --- a/notebooks/TBCK/phenopackets/PMID_27040691_Individual9-1.json +++ b/notebooks/TBCK/phenopackets/PMID_27040691_Individual9-1.json @@ -1,5 +1,5 @@ { - "id": "PMID_27040691_Individual_9-1", + "id": "PMID_27040691_Individual_9_1", "subject": { "id": "Individual 9-1", "timeAtLastEncounter": { @@ -7,6 +7,9 @@ "iso8601duration": "P10Y" } }, + "vitalStatus": { + "status": "ALIVE" + }, "sex": "FEMALE" }, "phenotypicFeatures": [ @@ -252,7 +255,7 @@ "interpretationStatus": "CAUSATIVE", "variantInterpretation": { "variationDescriptor": { - "id": "var_XAuxATXBOlDbhlSgUlioiPPXl", + "id": "var_DWosLmtFfRtbwNLlOHzKwRnBg", "label": "DELc.(658observed1_ 659-1)_ (2059observed1_2060-1del", "geneContext": { "valueId": "HGNC:28261", @@ -318,7 +321,7 @@ } ], "metaData": { - "created": "2024-04-28T17:04:44.490995883Z", + "created": "2024-10-04T18:13:39.641295909Z", "createdBy": "ORCID:0000-0002-0736-9199", "resources": [ { @@ -357,7 +360,7 @@ "id": "hp", "name": "human phenotype ontology", "url": "http://purl.obolibrary.org/obo/hp.owl", - "version": "2024-04-26", + "version": "2024-08-13", "namespacePrefix": "HP", "iriPrefix": "http://purl.obolibrary.org/obo/HP_" } diff --git a/notebooks/TBCK/phenopackets/PMID_27040691_Individual9-2.json b/notebooks/TBCK/phenopackets/PMID_27040691_Individual9-2.json index 0e964541e..3deef9af9 100644 --- a/notebooks/TBCK/phenopackets/PMID_27040691_Individual9-2.json +++ b/notebooks/TBCK/phenopackets/PMID_27040691_Individual9-2.json @@ -1,5 +1,5 @@ { - "id": "PMID_27040691_Individual_9-2", + "id": "PMID_27040691_Individual_9_2", "subject": { "id": "Individual 9-2", "timeAtLastEncounter": { @@ -7,6 +7,9 @@ "iso8601duration": "P2Y" } }, + "vitalStatus": { + "status": "ALIVE" + }, "sex": "MALE" }, "phenotypicFeatures": [ @@ -261,7 +264,7 @@ "interpretationStatus": "CAUSATIVE", "variantInterpretation": { "variationDescriptor": { - "id": "var_XAuxATXBOlDbhlSgUlioiPPXl", + "id": "var_DWosLmtFfRtbwNLlOHzKwRnBg", "label": "DELc.(658observed1_ 659-1)_ (2059observed1_2060-1del", "geneContext": { "valueId": "HGNC:28261", @@ -327,7 +330,7 @@ } ], "metaData": { - "created": "2024-04-28T17:04:44.492120027Z", + "created": "2024-10-04T18:13:39.642132043Z", "createdBy": "ORCID:0000-0002-0736-9199", "resources": [ { @@ -366,7 +369,7 @@ "id": "hp", "name": "human phenotype ontology", "url": "http://purl.obolibrary.org/obo/hp.owl", - "version": "2024-04-26", + "version": "2024-08-13", "namespacePrefix": "HP", "iriPrefix": "http://purl.obolibrary.org/obo/HP_" } diff --git a/notebooks/TBCK/phenopackets/PMID_27040692_A-II-1.json b/notebooks/TBCK/phenopackets/PMID_27040692_A-II-1.json index d8d1e3e84..a78edf279 100644 --- a/notebooks/TBCK/phenopackets/PMID_27040692_A-II-1.json +++ b/notebooks/TBCK/phenopackets/PMID_27040692_A-II-1.json @@ -1,5 +1,5 @@ { - "id": "PMID_27040692_A-II-1", + "id": "PMID_27040692_A_II_1", "subject": { "id": "A-II-1", "timeAtLastEncounter": { @@ -7,6 +7,9 @@ "iso8601duration": "P14Y" } }, + "vitalStatus": { + "status": "ALIVE" + }, "sex": "MALE" }, "phenotypicFeatures": [ @@ -223,7 +226,7 @@ } ], "metaData": { - "created": "2024-04-28T17:04:44.493196964Z", + "created": "2024-10-04T18:13:39.642899036Z", "createdBy": "ORCID:0000-0002-0736-9199", "resources": [ { @@ -262,7 +265,7 @@ "id": "hp", "name": "human phenotype ontology", "url": "http://purl.obolibrary.org/obo/hp.owl", - "version": "2024-04-26", + "version": "2024-08-13", "namespacePrefix": "HP", "iriPrefix": "http://purl.obolibrary.org/obo/HP_" } diff --git a/notebooks/TBCK/phenopackets/PMID_27040692_B-IV-4.json b/notebooks/TBCK/phenopackets/PMID_27040692_B-IV-4.json index 4baccee54..6923d06ac 100644 --- a/notebooks/TBCK/phenopackets/PMID_27040692_B-IV-4.json +++ b/notebooks/TBCK/phenopackets/PMID_27040692_B-IV-4.json @@ -1,5 +1,5 @@ { - "id": "PMID_27040692_B-IV-4", + "id": "PMID_27040692_B_IV_4", "subject": { "id": "B-IV-4", "timeAtLastEncounter": { @@ -7,6 +7,9 @@ "iso8601duration": "P4Y" } }, + "vitalStatus": { + "status": "ALIVE" + }, "sex": "FEMALE" }, "phenotypicFeatures": [ @@ -226,7 +229,7 @@ } ], "metaData": { - "created": "2024-04-28T17:04:44.493957996Z", + "created": "2024-10-04T18:13:39.643514156Z", "createdBy": "ORCID:0000-0002-0736-9199", "resources": [ { @@ -265,7 +268,7 @@ "id": "hp", "name": "human phenotype ontology", "url": "http://purl.obolibrary.org/obo/hp.owl", - "version": "2024-04-26", + "version": "2024-08-13", "namespacePrefix": "HP", "iriPrefix": "http://purl.obolibrary.org/obo/HP_" } diff --git a/notebooks/TBCK/phenopackets/PMID_27040692_B-IV-6.json b/notebooks/TBCK/phenopackets/PMID_27040692_B-IV-6.json index 1fa0cf342..b502749ec 100644 --- a/notebooks/TBCK/phenopackets/PMID_27040692_B-IV-6.json +++ b/notebooks/TBCK/phenopackets/PMID_27040692_B-IV-6.json @@ -1,5 +1,5 @@ { - "id": "PMID_27040692_B-IV-6", + "id": "PMID_27040692_B_IV_6", "subject": { "id": "B-IV-6", "timeAtLastEncounter": { @@ -7,6 +7,14 @@ "iso8601duration": "P10Y" } }, + "vitalStatus": { + "status": "DECEASED", + "timeOfDeath": { + "age": { + "iso8601duration": "P10Y" + } + } + }, "sex": "FEMALE" }, "phenotypicFeatures": [ @@ -215,7 +223,7 @@ } ], "metaData": { - "created": "2024-04-28T17:04:44.494726896Z", + "created": "2024-10-04T18:13:39.644118070Z", "createdBy": "ORCID:0000-0002-0736-9199", "resources": [ { @@ -254,7 +262,7 @@ "id": "hp", "name": "human phenotype ontology", "url": "http://purl.obolibrary.org/obo/hp.owl", - "version": "2024-04-26", + "version": "2024-08-13", "namespacePrefix": "HP", "iriPrefix": "http://purl.obolibrary.org/obo/HP_" } diff --git a/notebooks/TBCK/phenopackets/PMID_27040692_C-II-1.json b/notebooks/TBCK/phenopackets/PMID_27040692_C-II-1.json index c4acbef57..cf726c4ec 100644 --- a/notebooks/TBCK/phenopackets/PMID_27040692_C-II-1.json +++ b/notebooks/TBCK/phenopackets/PMID_27040692_C-II-1.json @@ -1,5 +1,5 @@ { - "id": "PMID_27040692_C-II-1", + "id": "PMID_27040692_C_II_1", "subject": { "id": "C-II-1", "timeAtLastEncounter": { @@ -7,6 +7,9 @@ "iso8601duration": "P2Y" } }, + "vitalStatus": { + "status": "ALIVE" + }, "sex": "MALE" }, "phenotypicFeatures": [ @@ -218,7 +221,7 @@ } ], "metaData": { - "created": "2024-04-28T17:04:44.495482921Z", + "created": "2024-10-04T18:13:39.644698143Z", "createdBy": "ORCID:0000-0002-0736-9199", "resources": [ { @@ -257,7 +260,7 @@ "id": "hp", "name": "human phenotype ontology", "url": "http://purl.obolibrary.org/obo/hp.owl", - "version": "2024-04-26", + "version": "2024-08-13", "namespacePrefix": "HP", "iriPrefix": "http://purl.obolibrary.org/obo/HP_" } diff --git a/notebooks/TBCK/phenopackets/PMID_27040692_D-II-1.json b/notebooks/TBCK/phenopackets/PMID_27040692_D-II-1.json index 2e097a572..355fc8009 100644 --- a/notebooks/TBCK/phenopackets/PMID_27040692_D-II-1.json +++ b/notebooks/TBCK/phenopackets/PMID_27040692_D-II-1.json @@ -1,5 +1,5 @@ { - "id": "PMID_27040692_D-II-1", + "id": "PMID_27040692_D_II_1", "subject": { "id": "D-II-1", "timeAtLastEncounter": { @@ -7,6 +7,9 @@ "iso8601duration": "P14Y" } }, + "vitalStatus": { + "status": "ALIVE" + }, "sex": "MALE" }, "phenotypicFeatures": [ @@ -226,7 +229,7 @@ } ], "metaData": { - "created": "2024-04-28T17:04:44.496216058Z", + "created": "2024-10-04T18:13:39.645308971Z", "createdBy": "ORCID:0000-0002-0736-9199", "resources": [ { @@ -265,7 +268,7 @@ "id": "hp", "name": "human phenotype ontology", "url": "http://purl.obolibrary.org/obo/hp.owl", - "version": "2024-04-26", + "version": "2024-08-13", "namespacePrefix": "HP", "iriPrefix": "http://purl.obolibrary.org/obo/HP_" } diff --git a/notebooks/TBCK/phenopackets/PMID_27275012_Patient1.json b/notebooks/TBCK/phenopackets/PMID_27275012_Patient1.json index d7be6b851..7ef583771 100644 --- a/notebooks/TBCK/phenopackets/PMID_27275012_Patient1.json +++ b/notebooks/TBCK/phenopackets/PMID_27275012_Patient1.json @@ -7,6 +7,14 @@ "iso8601duration": "P9Y" } }, + "vitalStatus": { + "status": "DECEASED", + "timeOfDeath": { + "age": { + "iso8601duration": "P9Y" + } + } + }, "sex": "MALE" }, "phenotypicFeatures": [ @@ -147,7 +155,7 @@ } ], "metaData": { - "created": "2024-04-28T17:04:44.497044086Z", + "created": "2024-10-04T18:13:39.645965099Z", "createdBy": "ORCID:0000-0002-0736-9199", "resources": [ { @@ -186,7 +194,7 @@ "id": "hp", "name": "human phenotype ontology", "url": "http://purl.obolibrary.org/obo/hp.owl", - "version": "2024-04-26", + "version": "2024-08-13", "namespacePrefix": "HP", "iriPrefix": "http://purl.obolibrary.org/obo/HP_" } diff --git a/notebooks/TBCK/phenopackets/PMID_27275012_Patient2.json b/notebooks/TBCK/phenopackets/PMID_27275012_Patient2.json index ff865f628..a943d8ba2 100644 --- a/notebooks/TBCK/phenopackets/PMID_27275012_Patient2.json +++ b/notebooks/TBCK/phenopackets/PMID_27275012_Patient2.json @@ -7,6 +7,9 @@ "iso8601duration": "P16Y" } }, + "vitalStatus": { + "status": "ALIVE" + }, "sex": "MALE" }, "phenotypicFeatures": [ @@ -141,7 +144,7 @@ } ], "metaData": { - "created": "2024-04-28T17:04:44.497622966Z", + "created": "2024-10-04T18:13:39.646433115Z", "createdBy": "ORCID:0000-0002-0736-9199", "resources": [ { @@ -180,7 +183,7 @@ "id": "hp", "name": "human phenotype ontology", "url": "http://purl.obolibrary.org/obo/hp.owl", - "version": "2024-04-26", + "version": "2024-08-13", "namespacePrefix": "HP", "iriPrefix": "http://purl.obolibrary.org/obo/HP_" } diff --git a/notebooks/TBCK/phenopackets/PMID_27275012_Patient3.json b/notebooks/TBCK/phenopackets/PMID_27275012_Patient3.json index 9b2676a38..115f5da4c 100644 --- a/notebooks/TBCK/phenopackets/PMID_27275012_Patient3.json +++ b/notebooks/TBCK/phenopackets/PMID_27275012_Patient3.json @@ -7,6 +7,9 @@ "iso8601duration": "P11Y" } }, + "vitalStatus": { + "status": "ALIVE" + }, "sex": "FEMALE" }, "phenotypicFeatures": [ @@ -134,7 +137,7 @@ } ], "metaData": { - "created": "2024-04-28T17:04:44.498183012Z", + "created": "2024-10-04T18:13:39.646827936Z", "createdBy": "ORCID:0000-0002-0736-9199", "resources": [ { @@ -173,7 +176,7 @@ "id": "hp", "name": "human phenotype ontology", "url": "http://purl.obolibrary.org/obo/hp.owl", - "version": "2024-04-26", + "version": "2024-08-13", "namespacePrefix": "HP", "iriPrefix": "http://purl.obolibrary.org/obo/HP_" } diff --git a/notebooks/TBCK/phenopackets/PMID_30103036_Patient1.json b/notebooks/TBCK/phenopackets/PMID_30103036_Patient1.json index 9247287f2..ce461eba0 100644 --- a/notebooks/TBCK/phenopackets/PMID_30103036_Patient1.json +++ b/notebooks/TBCK/phenopackets/PMID_30103036_Patient1.json @@ -7,6 +7,9 @@ "iso8601duration": "P5Y" } }, + "vitalStatus": { + "status": "ALIVE" + }, "sex": "FEMALE" }, "phenotypicFeatures": [ @@ -174,7 +177,7 @@ } ], "metaData": { - "created": "2024-04-28T17:04:44.498747825Z", + "created": "2024-10-04T18:13:39.647247076Z", "createdBy": "ORCID:0000-0002-0736-9199", "resources": [ { @@ -213,7 +216,7 @@ "id": "hp", "name": "human phenotype ontology", "url": "http://purl.obolibrary.org/obo/hp.owl", - "version": "2024-04-26", + "version": "2024-08-13", "namespacePrefix": "HP", "iriPrefix": "http://purl.obolibrary.org/obo/HP_" } diff --git a/notebooks/TBCK/phenopackets/PMID_30103036_Patient2.json b/notebooks/TBCK/phenopackets/PMID_30103036_Patient2.json index db453ac3d..4ae08f5e9 100644 --- a/notebooks/TBCK/phenopackets/PMID_30103036_Patient2.json +++ b/notebooks/TBCK/phenopackets/PMID_30103036_Patient2.json @@ -7,6 +7,9 @@ "iso8601duration": "P3Y" } }, + "vitalStatus": { + "status": "ALIVE" + }, "sex": "FEMALE" }, "phenotypicFeatures": [ @@ -170,7 +173,7 @@ } ], "metaData": { - "created": "2024-04-28T17:04:44.499418973Z", + "created": "2024-10-04T18:13:39.647698879Z", "createdBy": "ORCID:0000-0002-0736-9199", "resources": [ { @@ -209,7 +212,7 @@ "id": "hp", "name": "human phenotype ontology", "url": "http://purl.obolibrary.org/obo/hp.owl", - "version": "2024-04-26", + "version": "2024-08-13", "namespacePrefix": "HP", "iriPrefix": "http://purl.obolibrary.org/obo/HP_" } diff --git a/notebooks/TBCK/phenopackets/PMID_32363625_IndividualP1.json b/notebooks/TBCK/phenopackets/PMID_32363625_IndividualP1.json new file mode 100644 index 000000000..18d77ea79 --- /dev/null +++ b/notebooks/TBCK/phenopackets/PMID_32363625_IndividualP1.json @@ -0,0 +1,286 @@ +{ + "id": "PMID_32363625_Individual_P1", + "subject": { + "id": "Individual P1", + "timeAtLastEncounter": { + "age": { + "iso8601duration": "P13Y" + } + }, + "vitalStatus": { + "status": "ALIVE" + }, + "sex": "FEMALE" + }, + "phenotypicFeatures": [ + { + "type": { + "id": "HP:0000256", + "label": "Macrocephaly" + }, + "onset": { + "age": { + "iso8601duration": "P1Y4M" + } + } + }, + { + "type": { + "id": "HP:0007334", + "label": "Bilateral tonic-clonic seizure with focal onset" + }, + "onset": { + "age": { + "iso8601duration": "P1Y4M" + } + } + }, + { + "type": { + "id": "HP:0001252", + "label": "Hypotonia" + }, + "onset": { + "ontologyClass": { + "id": "HP:0003623", + "label": "Neonatal onset" + } + } + }, + { + "type": { + "id": "HP:0001007", + "label": "Hirsutism" + } + }, + { + "type": { + "id": "HP:0001182", + "label": "Tapered finger" + } + }, + { + "type": { + "id": "HP:0002650", + "label": "Scoliosis" + } + }, + { + "type": { + "id": "HP:0034392", + "label": "Joint contracture" + } + }, + { + "type": { + "id": "HP:0033725", + "label": "Thin corpus callosum" + } + }, + { + "type": { + "id": "HP:0002119", + "label": "Ventriculomegaly" + } + }, + { + "type": { + "id": "HP:0002280", + "label": "Enlarged cisterna magna" + } + }, + { + "type": { + "id": "HP:0001344", + "label": "Absent speech" + } + }, + { + "type": { + "id": "HP:0001270", + "label": "Motor delay" + } + }, + { + "type": { + "id": "HP:0001263", + "label": "Global developmental delay" + } + }, + { + "type": { + "id": "HP:0001265", + "label": "Hyporeflexia" + } + }, + { + "type": { + "id": "HP:0003557", + "label": "Increased variability in muscle fiber diameter" + } + }, + { + "type": { + "id": "HP:0008180", + "label": "Mildly elevated creatine kinase" + } + }, + { + "type": { + "id": "HP:0003690", + "label": "Limb muscle weakness" + } + }, + { + "type": { + "id": "HP:0003327", + "label": "Axial muscle weakness" + } + }, + { + "type": { + "id": "HP:0001272", + "label": "Cerebellar atrophy" + }, + "excluded": true + }, + { + "type": { + "id": "HP:0002283", + "label": "Global brain atrophy" + }, + "excluded": true + }, + { + "type": { + "id": "HP:0002376", + "label": "Developmental regression" + }, + "excluded": true + }, + { + "type": { + "id": "HP:0002133", + "label": "Status epilepticus" + }, + "excluded": true + } + ], + "interpretations": [ + { + "id": "Individual P1", + "progressStatus": "SOLVED", + "diagnosis": { + "disease": { + "id": "OMIM:616900", + "label": "Hypotonia, infantile, with psychomotor retardation and characteristic facies 3" + }, + "genomicInterpretations": [ + { + "subjectOrBiosampleId": "Individual P1", + "interpretationStatus": "CAUSATIVE", + "variantInterpretation": { + "variationDescriptor": { + "id": "var_fPJEBxZIuOFahHDKtewyUYFVa", + "geneContext": { + "valueId": "HGNC:28261", + "symbol": "TBCK" + }, + "expressions": [ + { + "syntax": "hgvs.c", + "value": "NM_001163435.3:c.535_554del" + }, + { + "syntax": "hgvs.g", + "value": "NC_000004.12:g.106251909_106251928del" + } + ], + "vcfRecord": { + "genomeAssembly": "hg38", + "chrom": "chr4", + "pos": "106251908", + "ref": "TGATTTGGGGCCAGAAGGCAA", + "alt": "T" + }, + "moleculeContext": "genomic", + "allelicState": { + "id": "GENO:0000136", + "label": "homozygous" + } + } + } + } + ] + } + } + ], + "diseases": [ + { + "term": { + "id": "OMIM:616900", + "label": "Hypotonia, infantile, with psychomotor retardation and characteristic facies 3" + }, + "onset": { + "ontologyClass": { + "id": "HP:0003623", + "label": "Neonatal onset" + } + } + } + ], + "metaData": { + "created": "2024-10-04T18:13:39.648858785Z", + "createdBy": "ORCID:0000-0002-0736-9199", + "resources": [ + { + "id": "geno", + "name": "Genotype Ontology", + "url": "http://purl.obolibrary.org/obo/geno.owl", + "version": "2022-03-05", + "namespacePrefix": "GENO", + "iriPrefix": "http://purl.obolibrary.org/obo/GENO_" + }, + { + "id": "hgnc", + "name": "HUGO Gene Nomenclature Committee", + "url": "https://www.genenames.org", + "version": "06/01/23", + "namespacePrefix": "HGNC", + "iriPrefix": "https://www.genenames.org/data/gene-symbol-report/#!/hgnc_id/" + }, + { + "id": "omim", + "name": "An Online Catalog of Human Genes and Genetic Disorders", + "url": "https://www.omim.org", + "version": "January 4, 2023", + "namespacePrefix": "OMIM", + "iriPrefix": "https://www.omim.org/entry/" + }, + { + "id": "so", + "name": "Sequence types and features ontology", + "url": "http://purl.obolibrary.org/obo/so.obo", + "version": "2021-11-22", + "namespacePrefix": "SO", + "iriPrefix": "http://purl.obolibrary.org/obo/SO_" + }, + { + "id": "hp", + "name": "human phenotype ontology", + "url": "http://purl.obolibrary.org/obo/hp.owl", + "version": "2024-08-13", + "namespacePrefix": "HP", + "iriPrefix": "http://purl.obolibrary.org/obo/HP_" + } + ], + "phenopacketSchemaVersion": "2.0", + "externalReferences": [ + { + "id": "PMID:32363625", + "reference": "https://pubmed.ncbi.nlm.nih.gov/32363625", + "description": "Myopathic changes associated with psychomotor delay and seizures caused by a novel homozygous mutation in TBCK" + } + ] + } +} \ No newline at end of file diff --git a/notebooks/TBCK/phenopackets/PMID_32363625_IndividualP2.json b/notebooks/TBCK/phenopackets/PMID_32363625_IndividualP2.json new file mode 100644 index 000000000..197d076db --- /dev/null +++ b/notebooks/TBCK/phenopackets/PMID_32363625_IndividualP2.json @@ -0,0 +1,273 @@ +{ + "id": "PMID_32363625_Individual_P2", + "subject": { + "id": "Individual P2", + "timeAtLastEncounter": { + "age": { + "iso8601duration": "P8Y" + } + }, + "vitalStatus": { + "status": "ALIVE" + }, + "sex": "FEMALE" + }, + "phenotypicFeatures": [ + { + "type": { + "id": "HP:0008180", + "label": "Mildly elevated creatine kinase" + }, + "onset": { + "ontologyClass": { + "id": "HP:0003623", + "label": "Neonatal onset" + } + } + }, + { + "type": { + "id": "HP:0007334", + "label": "Bilateral tonic-clonic seizure with focal onset" + }, + "onset": { + "age": { + "iso8601duration": "P9M" + } + } + }, + { + "type": { + "id": "HP:0033725", + "label": "Thin corpus callosum" + } + }, + { + "type": { + "id": "HP:0002119", + "label": "Ventriculomegaly" + } + }, + { + "type": { + "id": "HP:0001344", + "label": "Absent speech" + } + }, + { + "type": { + "id": "HP:0001270", + "label": "Motor delay" + } + }, + { + "type": { + "id": "HP:0001263", + "label": "Global developmental delay" + } + }, + { + "type": { + "id": "HP:0001265", + "label": "Hyporeflexia" + } + }, + { + "type": { + "id": "HP:0003557", + "label": "Increased variability in muscle fiber diameter" + } + }, + { + "type": { + "id": "HP:0003690", + "label": "Limb muscle weakness" + } + }, + { + "type": { + "id": "HP:0003327", + "label": "Axial muscle weakness" + } + }, + { + "type": { + "id": "HP:0001252", + "label": "Hypotonia" + } + }, + { + "type": { + "id": "HP:0001007", + "label": "Hirsutism" + }, + "excluded": true + }, + { + "type": { + "id": "HP:0001182", + "label": "Tapered finger" + }, + "excluded": true + }, + { + "type": { + "id": "HP:0002650", + "label": "Scoliosis" + }, + "excluded": true + }, + { + "type": { + "id": "HP:0034392", + "label": "Joint contracture" + }, + "excluded": true + }, + { + "type": { + "id": "HP:0001272", + "label": "Cerebellar atrophy" + }, + "excluded": true + }, + { + "type": { + "id": "HP:0002283", + "label": "Global brain atrophy" + }, + "excluded": true + }, + { + "type": { + "id": "HP:0002376", + "label": "Developmental regression" + }, + "excluded": true + }, + { + "type": { + "id": "HP:0002133", + "label": "Status epilepticus" + }, + "excluded": true + } + ], + "interpretations": [ + { + "id": "Individual P2", + "progressStatus": "SOLVED", + "diagnosis": { + "disease": { + "id": "OMIM:616900", + "label": "Hypotonia, infantile, with psychomotor retardation and characteristic facies 3" + }, + "genomicInterpretations": [ + { + "subjectOrBiosampleId": "Individual P2", + "interpretationStatus": "CAUSATIVE", + "variantInterpretation": { + "variationDescriptor": { + "id": "var_fPJEBxZIuOFahHDKtewyUYFVa", + "geneContext": { + "valueId": "HGNC:28261", + "symbol": "TBCK" + }, + "expressions": [ + { + "syntax": "hgvs.c", + "value": "NM_001163435.3:c.535_554del" + }, + { + "syntax": "hgvs.g", + "value": "NC_000004.12:g.106251909_106251928del" + } + ], + "vcfRecord": { + "genomeAssembly": "hg38", + "chrom": "chr4", + "pos": "106251908", + "ref": "TGATTTGGGGCCAGAAGGCAA", + "alt": "T" + }, + "moleculeContext": "genomic", + "allelicState": { + "id": "GENO:0000136", + "label": "homozygous" + } + } + } + } + ] + } + } + ], + "diseases": [ + { + "term": { + "id": "OMIM:616900", + "label": "Hypotonia, infantile, with psychomotor retardation and characteristic facies 3" + }, + "onset": { + "ontologyClass": { + "id": "HP:0003623", + "label": "Neonatal onset" + } + } + } + ], + "metaData": { + "created": "2024-10-04T18:13:39.649583101Z", + "createdBy": "ORCID:0000-0002-0736-9199", + "resources": [ + { + "id": "geno", + "name": "Genotype Ontology", + "url": "http://purl.obolibrary.org/obo/geno.owl", + "version": "2022-03-05", + "namespacePrefix": "GENO", + "iriPrefix": "http://purl.obolibrary.org/obo/GENO_" + }, + { + "id": "hgnc", + "name": "HUGO Gene Nomenclature Committee", + "url": "https://www.genenames.org", + "version": "06/01/23", + "namespacePrefix": "HGNC", + "iriPrefix": "https://www.genenames.org/data/gene-symbol-report/#!/hgnc_id/" + }, + { + "id": "omim", + "name": "An Online Catalog of Human Genes and Genetic Disorders", + "url": "https://www.omim.org", + "version": "January 4, 2023", + "namespacePrefix": "OMIM", + "iriPrefix": "https://www.omim.org/entry/" + }, + { + "id": "so", + "name": "Sequence types and features ontology", + "url": "http://purl.obolibrary.org/obo/so.obo", + "version": "2021-11-22", + "namespacePrefix": "SO", + "iriPrefix": "http://purl.obolibrary.org/obo/SO_" + }, + { + "id": "hp", + "name": "human phenotype ontology", + "url": "http://purl.obolibrary.org/obo/hp.owl", + "version": "2024-08-13", + "namespacePrefix": "HP", + "iriPrefix": "http://purl.obolibrary.org/obo/HP_" + } + ], + "phenopacketSchemaVersion": "2.0", + "externalReferences": [ + { + "id": "PMID:32363625", + "reference": "https://pubmed.ncbi.nlm.nih.gov/32363625", + "description": "Myopathic changes associated with psychomotor delay and seizures caused by a novel homozygous mutation in TBCK" + } + ] + } +} \ No newline at end of file diff --git a/notebooks/TBCK/phenopackets/PMID_36273129_patient.json b/notebooks/TBCK/phenopackets/PMID_36273129_patient.json new file mode 100644 index 000000000..a796c04fd --- /dev/null +++ b/notebooks/TBCK/phenopackets/PMID_36273129_patient.json @@ -0,0 +1,381 @@ +{ + "id": "PMID_36273129_patient", + "subject": { + "id": "patient", + "timeAtLastEncounter": { + "age": { + "iso8601duration": "P1Y3M" + } + }, + "vitalStatus": { + "status": "ALIVE" + }, + "sex": "MALE" + }, + "phenotypicFeatures": [ + { + "type": { + "id": "HP:0000256", + "label": "Macrocephaly" + }, + "onset": { + "ontologyClass": { + "id": "HP:0003577", + "label": "Congenital onset" + } + } + }, + { + "type": { + "id": "HP:0002283", + "label": "Global brain atrophy" + }, + "onset": { + "age": { + "iso8601duration": "P5M" + } + } + }, + { + "type": { + "id": "HP:0001252", + "label": "Hypotonia" + }, + "onset": { + "ontologyClass": { + "id": "HP:0003623", + "label": "Neonatal onset" + } + } + }, + { + "type": { + "id": "HP:0000158", + "label": "Macroglossia" + } + }, + { + "type": { + "id": "HP:0000280", + "label": "Coarse facial features" + } + }, + { + "type": { + "id": "HP:0010804", + "label": "Tented upper lip vermilion" + } + }, + { + "type": { + "id": "HP:0002553", + "label": "Highly arched eyebrow" + } + }, + { + "type": { + "id": "HP:0000316", + "label": "Hypertelorism" + } + }, + { + "type": { + "id": "HP:0002263", + "label": "Exaggerated cupid's bow" + } + }, + { + "type": { + "id": "HP:0000194", + "label": "Open mouth" + } + }, + { + "type": { + "id": "HP:0000750", + "label": "Delayed speech and language development" + } + }, + { + "type": { + "id": "HP:0001270", + "label": "Motor delay" + } + }, + { + "type": { + "id": "HP:0001265", + "label": "Hyporeflexia" + } + }, + { + "type": { + "id": "HP:0000028", + "label": "Cryptorchidism" + } + }, + { + "type": { + "id": "HP:0000767", + "label": "Pectus excavatum" + } + }, + { + "type": { + "id": "HP:0000212", + "label": "Gingival overgrowth" + }, + "excluded": true + }, + { + "type": { + "id": "HP:0000340", + "label": "Sloping forehead" + }, + "excluded": true + }, + { + "type": { + "id": "HP:0000343", + "label": "Long philtrum" + }, + "excluded": true + }, + { + "type": { + "id": "HP:0000582", + "label": "Upslanted palpebral fissure" + }, + "excluded": true + }, + { + "type": { + "id": "HP:0000286", + "label": "Epicanthus" + }, + "excluded": true + }, + { + "type": { + "id": "HP:0000303", + "label": "Mandibular prognathia" + }, + "excluded": true + }, + { + "type": { + "id": "HP:0000527", + "label": "Long eyelashes" + }, + "excluded": true + }, + { + "type": { + "id": "HP:0000664", + "label": "Synophrys" + }, + "excluded": true + }, + { + "type": { + "id": "HP:0000337", + "label": "Broad forehead" + }, + "excluded": true + }, + { + "type": { + "id": "HP:0000426", + "label": "Prominent nasal bridge" + }, + "excluded": true + }, + { + "type": { + "id": "HP:0000431", + "label": "Wide nasal bridge" + }, + "excluded": true + }, + { + "type": { + "id": "HP:0000463", + "label": "Anteverted nares" + }, + "excluded": true + }, + { + "type": { + "id": "HP:0000414", + "label": "Bulbous nose" + }, + "excluded": true + }, + { + "type": { + "id": "HP:0012471", + "label": "Thick vermilion border" + }, + "excluded": true + }, + { + "type": { + "id": "HP:0005487", + "label": "Prominent metopic ridge" + }, + "excluded": true + }, + { + "type": { + "id": "HP:0001007", + "label": "Hirsutism" + }, + "excluded": true + }, + { + "type": { + "id": "HP:0001272", + "label": "Cerebellar atrophy" + }, + "excluded": true + }, + { + "type": { + "id": "HP:0006970", + "label": "Periventricular leukomalacia" + }, + "excluded": true + }, + { + "type": { + "id": "HP:0001250", + "label": "Seizure" + }, + "excluded": true + }, + { + "type": { + "id": "HP:0000490", + "label": "Deeply set eye" + }, + "excluded": true + } + ], + "interpretations": [ + { + "id": "patient", + "progressStatus": "SOLVED", + "diagnosis": { + "disease": { + "id": "OMIM:616900", + "label": "Hypotonia, infantile, with psychomotor retardation and characteristic facies 3" + }, + "genomicInterpretations": [ + { + "subjectOrBiosampleId": "patient", + "interpretationStatus": "CAUSATIVE", + "variantInterpretation": { + "variationDescriptor": { + "id": "var_uDHWbTVzYhbMXcHfbcMWvlyYH", + "geneContext": { + "valueId": "HGNC:28261", + "symbol": "TBCK" + }, + "expressions": [ + { + "syntax": "hgvs.c", + "value": "NM_001163435.3:c.247C>T" + }, + { + "syntax": "hgvs.g", + "value": "NC_000004.12:g.106295113G>A" + } + ], + "vcfRecord": { + "genomeAssembly": "hg38", + "chrom": "chr4", + "pos": "106295113", + "ref": "G", + "alt": "A" + }, + "moleculeContext": "genomic", + "allelicState": { + "id": "GENO:0000136", + "label": "homozygous" + } + } + } + } + ] + } + } + ], + "diseases": [ + { + "term": { + "id": "OMIM:616900", + "label": "Hypotonia, infantile, with psychomotor retardation and characteristic facies 3" + }, + "onset": { + "ontologyClass": { + "id": "HP:0003577", + "label": "Congenital onset" + } + } + } + ], + "metaData": { + "created": "2024-10-04T18:13:39.648136854Z", + "createdBy": "ORCID:0000-0002-0736-9199", + "resources": [ + { + "id": "geno", + "name": "Genotype Ontology", + "url": "http://purl.obolibrary.org/obo/geno.owl", + "version": "2022-03-05", + "namespacePrefix": "GENO", + "iriPrefix": "http://purl.obolibrary.org/obo/GENO_" + }, + { + "id": "hgnc", + "name": "HUGO Gene Nomenclature Committee", + "url": "https://www.genenames.org", + "version": "06/01/23", + "namespacePrefix": "HGNC", + "iriPrefix": "https://www.genenames.org/data/gene-symbol-report/#!/hgnc_id/" + }, + { + "id": "omim", + "name": "An Online Catalog of Human Genes and Genetic Disorders", + "url": "https://www.omim.org", + "version": "January 4, 2023", + "namespacePrefix": "OMIM", + "iriPrefix": "https://www.omim.org/entry/" + }, + { + "id": "so", + "name": "Sequence types and features ontology", + "url": "http://purl.obolibrary.org/obo/so.obo", + "version": "2021-11-22", + "namespacePrefix": "SO", + "iriPrefix": "http://purl.obolibrary.org/obo/SO_" + }, + { + "id": "hp", + "name": "human phenotype ontology", + "url": "http://purl.obolibrary.org/obo/hp.owl", + "version": "2024-08-13", + "namespacePrefix": "HP", + "iriPrefix": "http://purl.obolibrary.org/obo/HP_" + } + ], + "phenopacketSchemaVersion": "2.0", + "externalReferences": [ + { + "id": "PMID:36273129", + "reference": "https://pubmed.ncbi.nlm.nih.gov/36273129", + "description": "Identification of a novel pathogenic TBCK variant in a Chinese patient with infantile hypotonia with psychomotor retardation and characteristic facies type 3 (IHPRF3): a case report" + } + ] + } +} \ No newline at end of file diff --git a/notebooks/TBCK/phenopackets/PMID_37876076_patient.json b/notebooks/TBCK/phenopackets/PMID_37876076_patient.json new file mode 100644 index 000000000..482903225 --- /dev/null +++ b/notebooks/TBCK/phenopackets/PMID_37876076_patient.json @@ -0,0 +1,300 @@ +{ + "id": "PMID_37876076_patient", + "subject": { + "id": "patient", + "timeAtLastEncounter": { + "age": { + "iso8601duration": "P6Y6M" + } + }, + "vitalStatus": { + "status": "ALIVE" + }, + "sex": "FEMALE" + }, + "phenotypicFeatures": [ + { + "type": { + "id": "HP:0012471", + "label": "Thick vermilion border" + } + }, + { + "type": { + "id": "HP:0000341", + "label": "Narrow forehead" + } + }, + { + "type": { + "id": "HP:0006970", + "label": "Periventricular leukomalacia" + } + }, + { + "type": { + "id": "HP:0001344", + "label": "Absent speech" + } + }, + { + "type": { + "id": "HP:0001270", + "label": "Motor delay" + } + }, + { + "type": { + "id": "HP:0001263", + "label": "Global developmental delay" + } + }, + { + "type": { + "id": "HP:0001265", + "label": "Hyporeflexia" + } + }, + { + "type": { + "id": "HP:0001252", + "label": "Hypotonia" + } + }, + { + "type": { + "id": "HP:0011968", + "label": "Feeding difficulties" + } + }, + { + "type": { + "id": "HP:0000158", + "label": "Macroglossia" + }, + "excluded": true + }, + { + "type": { + "id": "HP:0000212", + "label": "Gingival overgrowth" + }, + "excluded": true + }, + { + "type": { + "id": "HP:0000280", + "label": "Coarse facial features" + }, + "excluded": true + }, + { + "type": { + "id": "HP:0000340", + "label": "Sloping forehead" + }, + "excluded": true + }, + { + "type": { + "id": "HP:0010804", + "label": "Tented upper lip vermilion" + }, + "excluded": true + }, + { + "type": { + "id": "HP:0000582", + "label": "Upslanted palpebral fissure" + }, + "excluded": true + }, + { + "type": { + "id": "HP:0000286", + "label": "Epicanthus" + }, + "excluded": true + }, + { + "type": { + "id": "HP:0000316", + "label": "Hypertelorism" + }, + "excluded": true + }, + { + "type": { + "id": "HP:0000664", + "label": "Synophrys" + }, + "excluded": true + }, + { + "type": { + "id": "HP:0000426", + "label": "Prominent nasal bridge" + }, + "excluded": true + }, + { + "type": { + "id": "HP:0000431", + "label": "Wide nasal bridge" + }, + "excluded": true + }, + { + "type": { + "id": "HP:0002263", + "label": "Exaggerated cupid's bow" + }, + "excluded": true + }, + { + "type": { + "id": "HP:0000463", + "label": "Anteverted nares" + }, + "excluded": true + }, + { + "type": { + "id": "HP:0000414", + "label": "Bulbous nose" + }, + "excluded": true + }, + { + "type": { + "id": "HP:0005487", + "label": "Prominent metopic ridge" + }, + "excluded": true + }, + { + "type": { + "id": "HP:0000248", + "label": "Brachycephaly" + }, + "excluded": true + } + ], + "interpretations": [ + { + "id": "patient", + "progressStatus": "SOLVED", + "diagnosis": { + "disease": { + "id": "OMIM:616900", + "label": "Hypotonia, infantile, with psychomotor retardation and characteristic facies 3" + }, + "genomicInterpretations": [ + { + "subjectOrBiosampleId": "patient", + "interpretationStatus": "CAUSATIVE", + "variantInterpretation": { + "variationDescriptor": { + "id": "var_AGPvaTXSYAhSQoTccRuIIztWn", + "geneContext": { + "valueId": "HGNC:28261", + "symbol": "TBCK" + }, + "expressions": [ + { + "syntax": "hgvs.c", + "value": "NM_001163435.3:c.490C>T" + }, + { + "syntax": "hgvs.g", + "value": "NC_000004.12:g.106251973G>A" + } + ], + "vcfRecord": { + "genomeAssembly": "hg38", + "chrom": "chr4", + "pos": "106251973", + "ref": "G", + "alt": "A" + }, + "moleculeContext": "genomic", + "allelicState": { + "id": "GENO:0000136", + "label": "homozygous" + } + } + } + } + ] + } + } + ], + "diseases": [ + { + "term": { + "id": "OMIM:616900", + "label": "Hypotonia, infantile, with psychomotor retardation and characteristic facies 3" + }, + "onset": { + "ontologyClass": { + "id": "HP:0003593", + "label": "Infantile onset" + } + } + } + ], + "metaData": { + "created": "2024-10-04T18:13:39.650196075Z", + "createdBy": "ORCID:0000-0002-0736-9199", + "resources": [ + { + "id": "geno", + "name": "Genotype Ontology", + "url": "http://purl.obolibrary.org/obo/geno.owl", + "version": "2022-03-05", + "namespacePrefix": "GENO", + "iriPrefix": "http://purl.obolibrary.org/obo/GENO_" + }, + { + "id": "hgnc", + "name": "HUGO Gene Nomenclature Committee", + "url": "https://www.genenames.org", + "version": "06/01/23", + "namespacePrefix": "HGNC", + "iriPrefix": "https://www.genenames.org/data/gene-symbol-report/#!/hgnc_id/" + }, + { + "id": "omim", + "name": "An Online Catalog of Human Genes and Genetic Disorders", + "url": "https://www.omim.org", + "version": "January 4, 2023", + "namespacePrefix": "OMIM", + "iriPrefix": "https://www.omim.org/entry/" + }, + { + "id": "so", + "name": "Sequence types and features ontology", + "url": "http://purl.obolibrary.org/obo/so.obo", + "version": "2021-11-22", + "namespacePrefix": "SO", + "iriPrefix": "http://purl.obolibrary.org/obo/SO_" + }, + { + "id": "hp", + "name": "human phenotype ontology", + "url": "http://purl.obolibrary.org/obo/hp.owl", + "version": "2024-08-13", + "namespacePrefix": "HP", + "iriPrefix": "http://purl.obolibrary.org/obo/HP_" + } + ], + "phenopacketSchemaVersion": "2.0", + "externalReferences": [ + { + "id": "PMID:37876076", + "reference": "https://pubmed.ncbi.nlm.nih.gov/37876076", + "description": "Mutation Of TBC1 Domain Containing Kinase (TBCK) With Associated Intellectual Disability And Hypotonia" + } + ] + } +} \ No newline at end of file